Mutagenetix > Incidental Mutation

Incidental Mutation 'R6820:Wbp2nl'

537587

Institutional Source

Beutler Lab

Gene Symbol

Wbp2nl

Ensembl Gene

ENSMUSG00000022455

Gene Name

WBP2 N-terminal like

Synonyms

4930521I23Rik, PAWP

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6820 (G1)

Quality Score

211.009

Status

Validated

Chromosome

Chromosomal Location

82298954-82314623 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 82313795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 178 (A178S)

Ref Sequence

ENSEMBL: ENSMUSP00000023089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023089]

AlphaFold

Q9D529

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023089
AA Change: A178S

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000023089
Gene: ENSMUSG00000022455
AA Change: A178S

Domain	Start	End	E-Value	Type
Pfam:GRAM	4	87	1e-9	PFAM
Pfam:WWbp	103	226	2e-23	PFAM
low complexity region	238	262	N/A	INTRINSIC
low complexity region	277	288	N/A	INTRINSIC

Meta Mutation Damage Score

0.1473

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WBP2NL is a sperm-specific WW domain-binding protein that promotes meiotic resumption and pronuclear development during oocyte fertilization (Wu et al., 2007 [PubMed 17289678]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit normal sperm morphology, acrosomal reaction, egg activation and fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Accs	T	A	2: 93,842,921	N141Y	probably null	Het
Chkb	A	G	15: 89,428,176	L46P	probably damaging	Het
Col9a3	G	A	2: 180,607,134	V260M	probably damaging	Het
Dna2	T	C	10: 62,964,904	I739T	possibly damaging	Het
Dnah17	T	C	11: 118,069,000	H2620R	probably damaging	Het
Dsel	A	G	1: 111,859,817	V996A	probably damaging	Het
Dst	T	C	1: 34,211,256	L1757S	probably damaging	Het
Exoc5	A	T	14: 49,048,930		probably null	Het
Fam120a	A	T	13: 48,880,992	V1048E	possibly damaging	Het
Fam213b	A	T	4: 154,898,166	D50E	probably damaging	Het
Fam50b	G	A	13: 34,747,101	E187K	possibly damaging	Het
Fbxw19	T	A	9: 109,482,011	T377S	probably benign	Het
Fbxw28	A	T	9: 109,338,425	F88Y	probably damaging	Het
Grik5	C	T	7: 25,046,355	R431Q	possibly damaging	Het
Gtsf1	T	C	15: 103,420,527	T92A	probably benign	Het
Hoxc13	A	G	15: 102,921,822	Y212C	probably damaging	Het
Itih2	T	C	2: 10,098,098	I742V	probably benign	Het
Kat7	T	C	11: 95,284,139	T351A	probably damaging	Het
Mlh3	T	C	12: 85,247,723	D1233G	probably damaging	Het
Mroh2b	A	G	15: 4,953,274	D1525G	probably damaging	Het
Nme5	T	C	18: 34,571,573	Y73C	probably damaging	Het
Nr3c2	T	C	8: 77,242,457	V957A	probably damaging	Het
Nup153	A	G	13: 46,709,983	S301P	probably benign	Het
Obscn	T	C	11: 59,051,193	D5013G	probably damaging	Het
Olfr1278	C	T	2: 111,293,110	P281S	probably damaging	Het
Olfr470	A	G	7: 107,845,091	V214A	probably benign	Het
Olfr919	A	G	9: 38,697,475	V297A	possibly damaging	Het
Pak1	A	G	7: 97,886,379	N226D	probably benign	Het
Pak4	A	G	7: 28,563,036	Y384H	probably benign	Het
Pkp3	T	C	7: 141,079,844		probably null	Het
Psd	G	T	19: 46,320,844	A558E	probably damaging	Het
Psmd14	C	A	2: 61,776,724	H172N	probably benign	Het
Pygb	G	T	2: 150,816,754	W366L	possibly damaging	Het
Rbm39	A	T	2: 156,179,226	M1K	probably null	Het
Rnf213	T	C	11: 119,448,838	I3421T	probably damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Smg6	T	C	11: 75,041,964	V88A	probably damaging	Het
Tha1	T	C	11: 117,871,678	E80G	probably benign	Het
Tie1	A	G	4: 118,484,386	V243A	probably damaging	Het
Tmem215	T	C	4: 40,473,926	M1T	probably null	Het
Tpm2	A	G	4: 43,518,443	Y221H	probably damaging	Het
Ubap1	C	T	4: 41,379,854	P356L	probably benign	Het
Wdr54	A	T	6: 83,154,619	S139T	probably benign	Het
Wipi2	G	C	5: 142,629,800	Q14H	probably benign	Het
Zan	T	C	5: 137,407,844		probably benign	Het
Zfp735	A	G	11: 73,688,957	M1V	probably null	Het

Other mutations in Wbp2nl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00654:Wbp2nl	APN	15	82314210	missense	probably benign	0.03
IGL01074:Wbp2nl	APN	15	82314290	missense	possibly damaging	0.73
IGL01295:Wbp2nl	APN	15	82306418	missense	probably damaging	1.00
IGL01621:Wbp2nl	APN	15	82308605	missense	probably benign
IGL01735:Wbp2nl	APN	15	82313816	missense	probably benign
IGL01987:Wbp2nl	APN	15	82308561	missense	probably benign	0.03
IGL02426:Wbp2nl	APN	15	82306173	missense	probably damaging	1.00
IGL02900:Wbp2nl	APN	15	82313834	missense	probably benign
IGL02971:Wbp2nl	APN	15	82305744	missense	possibly damaging	0.61
R0194:Wbp2nl	UTSW	15	82314282	missense	possibly damaging	0.93
R0242:Wbp2nl	UTSW	15	82313787	missense	probably benign
R0242:Wbp2nl	UTSW	15	82313787	missense	probably benign
R0909:Wbp2nl	UTSW	15	82314074	missense	probably benign	0.41
R1442:Wbp2nl	UTSW	15	82314206	missense	probably benign
R1753:Wbp2nl	UTSW	15	82305744	missense	probably damaging	0.97
R4085:Wbp2nl	UTSW	15	82308561	missense	probably benign	0.07
R4086:Wbp2nl	UTSW	15	82308561	missense	probably benign	0.07
R4087:Wbp2nl	UTSW	15	82308561	missense	probably benign	0.07
R4726:Wbp2nl	UTSW	15	82306054	missense	probably damaging	1.00
R4840:Wbp2nl	UTSW	15	82314336	missense	possibly damaging	0.96
R6338:Wbp2nl	UTSW	15	82299045	missense	possibly damaging	0.94
R6339:Wbp2nl	UTSW	15	82299045	missense	possibly damaging	0.94
R7156:Wbp2nl	UTSW	15	82305702	missense	probably damaging	1.00
R7323:Wbp2nl	UTSW	15	82314341	makesense	probably null
R7598:Wbp2nl	UTSW	15	82308561	missense	probably benign	0.07
R7857:Wbp2nl	UTSW	15	82306072	missense	probably benign	0.24
R7903:Wbp2nl	UTSW	15	82306131	nonsense	probably null
R9242:Wbp2nl	UTSW	15	82308547	missense	probably benign	0.22
R9379:Wbp2nl	UTSW	15	82314110	missense	possibly damaging	0.83
Z1177:Wbp2nl	UTSW	15	82308564	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGAAACGCCATCTTTCTCTCC -3'
(R):5'- TCCGTATCTCACAGGTGGAG -3'

Sequencing Primer
(F):5'- CTCCCTGGTAATGGCTAAAGATCAG -3'
(R):5'- TGGAACTCCATAGCCCATTGG -3'

Posted On

2018-10-18