Incidental Mutation 'R6820:Wbp2nl'
ID537587
Institutional Source Beutler Lab
Gene Symbol Wbp2nl
Ensembl Gene ENSMUSG00000022455
Gene NameWBP2 N-terminal like
Synonyms4930521I23Rik, PAWP
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6820 (G1)
Quality Score211.009
Status Validated
Chromosome15
Chromosomal Location82298954-82314623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 82313795 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 178 (A178S)
Ref Sequence ENSEMBL: ENSMUSP00000023089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023089]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023089
AA Change: A178S

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023089
Gene: ENSMUSG00000022455
AA Change: A178S

DomainStartEndE-ValueType
Pfam:GRAM 4 87 1e-9 PFAM
Pfam:WWbp 103 226 2e-23 PFAM
low complexity region 238 262 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
Meta Mutation Damage Score 0.1473 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WBP2NL is a sperm-specific WW domain-binding protein that promotes meiotic resumption and pronuclear development during oocyte fertilization (Wu et al., 2007 [PubMed 17289678]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit normal sperm morphology, acrosomal reaction, egg activation and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs T A 2: 93,842,921 N141Y probably null Het
Chkb A G 15: 89,428,176 L46P probably damaging Het
Col9a3 G A 2: 180,607,134 V260M probably damaging Het
Dna2 T C 10: 62,964,904 I739T possibly damaging Het
Dnah17 T C 11: 118,069,000 H2620R probably damaging Het
Dsel A G 1: 111,859,817 V996A probably damaging Het
Dst T C 1: 34,211,256 L1757S probably damaging Het
Exoc5 A T 14: 49,048,930 probably null Het
Fam120a A T 13: 48,880,992 V1048E possibly damaging Het
Fam213b A T 4: 154,898,166 D50E probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fbxw19 T A 9: 109,482,011 T377S probably benign Het
Fbxw28 A T 9: 109,338,425 F88Y probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Gtsf1 T C 15: 103,420,527 T92A probably benign Het
Hoxc13 A G 15: 102,921,822 Y212C probably damaging Het
Itih2 T C 2: 10,098,098 I742V probably benign Het
Kat7 T C 11: 95,284,139 T351A probably damaging Het
Mlh3 T C 12: 85,247,723 D1233G probably damaging Het
Mroh2b A G 15: 4,953,274 D1525G probably damaging Het
Nme5 T C 18: 34,571,573 Y73C probably damaging Het
Nr3c2 T C 8: 77,242,457 V957A probably damaging Het
Nup153 A G 13: 46,709,983 S301P probably benign Het
Obscn T C 11: 59,051,193 D5013G probably damaging Het
Olfr1278 C T 2: 111,293,110 P281S probably damaging Het
Olfr470 A G 7: 107,845,091 V214A probably benign Het
Olfr919 A G 9: 38,697,475 V297A possibly damaging Het
Pak1 A G 7: 97,886,379 N226D probably benign Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pkp3 T C 7: 141,079,844 probably null Het
Psd G T 19: 46,320,844 A558E probably damaging Het
Psmd14 C A 2: 61,776,724 H172N probably benign Het
Pygb G T 2: 150,816,754 W366L possibly damaging Het
Rbm39 A T 2: 156,179,226 M1K probably null Het
Rnf213 T C 11: 119,448,838 I3421T probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Smg6 T C 11: 75,041,964 V88A probably damaging Het
Tha1 T C 11: 117,871,678 E80G probably benign Het
Tie1 A G 4: 118,484,386 V243A probably damaging Het
Tmem215 T C 4: 40,473,926 M1T probably null Het
Tpm2 A G 4: 43,518,443 Y221H probably damaging Het
Ubap1 C T 4: 41,379,854 P356L probably benign Het
Wdr54 A T 6: 83,154,619 S139T probably benign Het
Wipi2 G C 5: 142,629,800 Q14H probably benign Het
Zan T C 5: 137,407,844 probably benign Het
Zfp735 A G 11: 73,688,957 M1V probably null Het
Other mutations in Wbp2nl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Wbp2nl APN 15 82314210 missense probably benign 0.03
IGL01074:Wbp2nl APN 15 82314290 missense possibly damaging 0.73
IGL01295:Wbp2nl APN 15 82306418 missense probably damaging 1.00
IGL01621:Wbp2nl APN 15 82308605 missense probably benign
IGL01735:Wbp2nl APN 15 82313816 missense probably benign
IGL01987:Wbp2nl APN 15 82308561 missense probably benign 0.03
IGL02426:Wbp2nl APN 15 82306173 missense probably damaging 1.00
IGL02900:Wbp2nl APN 15 82313834 missense probably benign
IGL02971:Wbp2nl APN 15 82305744 missense possibly damaging 0.61
R0194:Wbp2nl UTSW 15 82314282 missense possibly damaging 0.93
R0242:Wbp2nl UTSW 15 82313787 missense probably benign
R0242:Wbp2nl UTSW 15 82313787 missense probably benign
R0909:Wbp2nl UTSW 15 82314074 missense probably benign 0.41
R1442:Wbp2nl UTSW 15 82314206 missense probably benign
R1753:Wbp2nl UTSW 15 82305744 missense probably damaging 0.97
R4085:Wbp2nl UTSW 15 82308561 missense probably benign 0.07
R4086:Wbp2nl UTSW 15 82308561 missense probably benign 0.07
R4087:Wbp2nl UTSW 15 82308561 missense probably benign 0.07
R4726:Wbp2nl UTSW 15 82306054 missense probably damaging 1.00
R4840:Wbp2nl UTSW 15 82314336 missense possibly damaging 0.96
R6338:Wbp2nl UTSW 15 82299045 missense possibly damaging 0.94
R6339:Wbp2nl UTSW 15 82299045 missense possibly damaging 0.94
R7156:Wbp2nl UTSW 15 82305702 missense probably damaging 1.00
R7323:Wbp2nl UTSW 15 82314341 makesense probably null
R7598:Wbp2nl UTSW 15 82308561 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AAGAAACGCCATCTTTCTCTCC -3'
(R):5'- TCCGTATCTCACAGGTGGAG -3'

Sequencing Primer
(F):5'- CTCCCTGGTAATGGCTAAAGATCAG -3'
(R):5'- TGGAACTCCATAGCCCATTGG -3'
Posted On2018-10-18