Incidental Mutation 'R6820:Hoxc13'
ID537589
Institutional Source Beutler Lab
Gene Symbol Hoxc13
Ensembl Gene ENSMUSG00000001655
Gene Namehomeobox C13
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6820 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location102921103-102928814 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102921822 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 212 (Y212C)
Ref Sequence ENSEMBL: ENSMUSP00000001700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001700]
Predicted Effect probably damaging
Transcript: ENSMUST00000001700
AA Change: Y212C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001700
Gene: ENSMUSG00000001655
AA Change: Y212C

DomainStartEndE-ValueType
low complexity region 22 50 N/A INTRINSIC
Pfam:HoxA13_N 52 166 1.7e-38 PFAM
HOX 258 320 6.12e-22 SMART
Meta Mutation Damage Score 0.5929 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. The product of this gene may play a role in the development of hair, nail, and filiform papilla. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit alopecia due to brittle hair, poor growth, abnormalities of caudal vertebrae, nails, and tongue filiform papillae, and lethality in the second week. Rare survivors recover, but lack hair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs T A 2: 93,842,921 N141Y probably null Het
Chkb A G 15: 89,428,176 L46P probably damaging Het
Col9a3 G A 2: 180,607,134 V260M probably damaging Het
Dna2 T C 10: 62,964,904 I739T possibly damaging Het
Dnah17 T C 11: 118,069,000 H2620R probably damaging Het
Dsel A G 1: 111,859,817 V996A probably damaging Het
Dst T C 1: 34,211,256 L1757S probably damaging Het
Exoc5 A T 14: 49,048,930 probably null Het
Fam120a A T 13: 48,880,992 V1048E possibly damaging Het
Fam213b A T 4: 154,898,166 D50E probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fbxw19 T A 9: 109,482,011 T377S probably benign Het
Fbxw28 A T 9: 109,338,425 F88Y probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Gtsf1 T C 15: 103,420,527 T92A probably benign Het
Itih2 T C 2: 10,098,098 I742V probably benign Het
Kat7 T C 11: 95,284,139 T351A probably damaging Het
Mlh3 T C 12: 85,247,723 D1233G probably damaging Het
Mroh2b A G 15: 4,953,274 D1525G probably damaging Het
Nme5 T C 18: 34,571,573 Y73C probably damaging Het
Nr3c2 T C 8: 77,242,457 V957A probably damaging Het
Nup153 A G 13: 46,709,983 S301P probably benign Het
Obscn T C 11: 59,051,193 D5013G probably damaging Het
Olfr1278 C T 2: 111,293,110 P281S probably damaging Het
Olfr470 A G 7: 107,845,091 V214A probably benign Het
Olfr919 A G 9: 38,697,475 V297A possibly damaging Het
Pak1 A G 7: 97,886,379 N226D probably benign Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pkp3 T C 7: 141,079,844 probably null Het
Psd G T 19: 46,320,844 A558E probably damaging Het
Psmd14 C A 2: 61,776,724 H172N probably benign Het
Pygb G T 2: 150,816,754 W366L possibly damaging Het
Rbm39 A T 2: 156,179,226 M1K probably null Het
Rnf213 T C 11: 119,448,838 I3421T probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Smg6 T C 11: 75,041,964 V88A probably damaging Het
Tha1 T C 11: 117,871,678 E80G probably benign Het
Tie1 A G 4: 118,484,386 V243A probably damaging Het
Tmem215 T C 4: 40,473,926 M1T probably null Het
Tpm2 A G 4: 43,518,443 Y221H probably damaging Het
Ubap1 C T 4: 41,379,854 P356L probably benign Het
Wbp2nl G T 15: 82,313,795 A178S possibly damaging Het
Wdr54 A T 6: 83,154,619 S139T probably benign Het
Wipi2 G C 5: 142,629,800 Q14H probably benign Het
Zan T C 5: 137,407,844 probably benign Het
Zfp735 A G 11: 73,688,957 M1V probably null Het
Other mutations in Hoxc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02563:Hoxc13 APN 15 102921798 missense possibly damaging 0.76
R2125:Hoxc13 UTSW 15 102927223 missense probably damaging 1.00
R3741:Hoxc13 UTSW 15 102921438 missense possibly damaging 0.84
R3742:Hoxc13 UTSW 15 102921438 missense possibly damaging 0.84
R3977:Hoxc13 UTSW 15 102921240 missense possibly damaging 0.60
R3978:Hoxc13 UTSW 15 102921240 missense possibly damaging 0.60
R7127:Hoxc13 UTSW 15 102921468 missense possibly damaging 0.87
R7719:Hoxc13 UTSW 15 102921858 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ACGTGAACCTGCAGCAGAAG -3'
(R):5'- ATTCCTCAGCATAGCTCGC -3'

Sequencing Primer
(F):5'- TACCATCCGGGGGACAAGTAC -3'
(R):5'- ATCGACAGCCTAGCCGAG -3'
Posted On2018-10-18