Mutagenetix > Incidental Mutations

Incidental Mutation 'R6821:Epha4'

537595

Institutional Source

Beutler Lab

Gene Symbol

Epha4

Ensembl Gene

ENSMUSG00000026235

Gene Name

Eph receptor A4

Synonyms

rb, Sek, Sek1, 2900005C20Rik, Cek8, Hek8, Tyro1

MMRRC Submission

Accession Numbers

Genbank: NM_007936; MGI: 98277

Is this an essential gene?

Probably essential (E-score: 0.927) question?

Stock #

R6821 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77367185-77515088 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 77382945 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 757 (N757S)

Ref Sequence

ENSEMBL: ENSMUSP00000139640 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027451] [ENSMUST00000188797] [ENSMUST00000188952] [ENSMUST00000190149]

PDB Structure

THE CRYSTAL STRUCTURE OF AN EPH RECEPTOR SAM DOMAIN REVEALS A MECHANISM FOR MODULAR DIMERIZATION. [X-RAY DIFFRACTION]
Crystal structure of a mutant EphA4 kinase domain (Y742A) [X-RAY DIFFRACTION]
[]
Crystal structure of EphA4 kinase domain in complex with VUF 12058 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF EPHA4 KINASE DOMAIN [X-RAY DIFFRACTION]
Crystal structure of EphA4 kinase domain in complex with Dasatinib. [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027451
AA Change: N757S

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000027451
Gene: ENSMUSG00000026235
AA Change: N757S

Domain	Start	End	E-Value	Type
EPH_lbd	30	204	1.35e-128	SMART
FN3	329	420	1.94e-8	SMART
FN3	441	522	9.18e-10	SMART
Pfam:EphA2_TM	548	618	1.7e-24	PFAM
TyrKc	621	878	1.91e-134	SMART
SAM	908	975	1.96e-20	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188797
AA Change: N757S

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140954
Gene: ENSMUSG00000026235
AA Change: N757S

Domain	Start	End	E-Value	Type
EPH_lbd	30	204	1.35e-128	SMART
FN3	329	420	1.94e-8	SMART
FN3	441	522	9.18e-10	SMART
Pfam:EphA2_TM	547	618	1.8e-27	PFAM
TyrKc	621	878	1.91e-134	SMART
SAM	908	975	1.96e-20	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188952
AA Change: N757S

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000139640
Gene: ENSMUSG00000026235
AA Change: N757S

Domain	Start	End	E-Value	Type
EPH_lbd	30	204	1.35e-128	SMART
FN3	329	420	1.94e-8	SMART
FN3	441	522	9.18e-10	SMART
Pfam:EphA2_TM	547	618	1.8e-27	PFAM
TyrKc	621	878	1.91e-134	SMART
SAM	908	975	1.96e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190149

Meta Mutation Damage Score

0.2555

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mutants are known for their "hopping gait". Homozygotes for targeted null mutations show loss of limb alternation in locomotion and axon guidance defects of the corticospinal tract within medulla and spinal cord, resulting in aberrant midline projections. Heterozygotes show less severe phenotype. [provided by MGI curators]

Allele List at MGI

All alleles(66) : Targeted, knock-out(3) Targeted, other(9) Gene trapped(52) Spontaneous(2)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl5	T	C	19: 55,288,836	I417T	probably benign	Het
Adamts12	A	C	15: 11,152,048	K208T	probably benign	Het
Adamts8	T	A	9: 30,956,626	L582Q	probably benign	Het
Aim2	C	G	1: 173,463,980	T317R	probably damaging	Het
Ano9	A	T	7: 141,107,256	F357I	possibly damaging	Het
Aox3	T	C	1: 58,150,388	V416A	probably benign	Het
Arhgap21	A	C	2: 20,848,848	F1901C	probably benign	Het
Atp8b2	A	T	3: 89,948,173	F506I	probably damaging	Het
Atp9b	A	T	18: 80,847,248	L292H	probably damaging	Het
C2cd5	A	G	6: 143,017,986	V891A	probably damaging	Het
Ccnt2	T	C	1: 127,803,335	S650P	probably damaging	Het
Cdhr3	T	A	12: 33,035,045	N791Y	probably damaging	Het
Cmtm1	TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG	TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG	8: 104,309,702		probably null	Het
D630003M21Rik	A	C	2: 158,204,774	L761R	probably damaging	Het
Draxin	G	T	4: 148,115,691	Q101K	possibly damaging	Het
Dtx3l	A	T	16: 35,933,060	L392Q	probably damaging	Het
Eif3d	A	G	15: 77,961,655	S389P	possibly damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Fam228b	T	C	12: 4,763,083	I96V	probably benign	Het
Gars	A	G	6: 55,079,338	E728G	probably benign	Het
Gldn	T	C	9: 54,338,770	M535T	probably benign	Het
Gm13089	A	T	4: 143,699,304	L23*	probably null	Het
Gm47985	A	G	1: 151,183,036	T143A	possibly damaging	Het
Gpr6	T	C	10: 41,071,008	T193A	probably benign	Het
Grik5	C	T	7: 25,046,355	R431Q	possibly damaging	Het
Hecw1	T	A	13: 14,264,134	Y1315F	probably damaging	Het
Hs3st2	A	G	7: 121,500,522	D197G	possibly damaging	Het
Igsf9	T	C	1: 172,484,493	I2T	probably benign	Het
Ints9	A	G	14: 65,037,458	E621G	probably benign	Het
Itm2b	G	A	14: 73,366,467	P47S	probably benign	Het
Map10	A	G	8: 125,670,399	K177R	probably benign	Het
Mdh2	T	C	5: 135,789,671	F260S	possibly damaging	Het
Mtmr11	A	G	3: 96,170,407	T573A	probably benign	Het
Mycbp2	A	T	14: 103,139,409	I3812N	probably damaging	Het
Myo15	A	G	11: 60,524,475	N3403S	probably damaging	Het
Nvl	G	A	1: 181,126,970	Q343*	probably null	Het
Ocstamp	A	T	2: 165,397,922	S115T	probably benign	Het
Olfr632	A	T	7: 103,937,586	I69F	probably benign	Het
Otoa	G	A	7: 121,092,847		probably null	Het
Pcdhb20	A	T	18: 37,506,122	N567I	probably damaging	Het
Pgm5	A	T	19: 24,861,647	V48E	possibly damaging	Het
Phlpp1	T	A	1: 106,386,444	S1182R	probably damaging	Het
Pik3r4	T	A	9: 105,650,606	L386Q	probably damaging	Het
Pop1	A	G	15: 34,508,639	K287E	possibly damaging	Het
Rad54b	A	G	4: 11,612,777	D803G	probably damaging	Het
Rbm26	G	A	14: 105,116,964		probably benign	Het
Rspry1	C	T	8: 94,635,431	Q113*	probably null	Het
Siah2	T	A	3: 58,691,770	S16C	probably benign	Het
Sirpa	C	A	2: 129,630,097	D481E	probably damaging	Het
Slc38a7	A	C	8: 95,844,920	D227E	probably benign	Het
Smc5	A	G	19: 23,242,787	V438A	probably benign	Het
Spast	A	G	17: 74,351,962	E108G	probably benign	Het
Speg	A	G	1: 75,417,903	E1752G	possibly damaging	Het
Tanc2	T	G	11: 105,886,490		probably null	Het
Tgfbi	T	C	13: 56,626,137	I243T	possibly damaging	Het
Tlr12	T	C	4: 128,616,892	S522G	possibly damaging	Het
Trav14-3	A	G	14: 53,763,472	I47V	probably benign	Het
Tsc22d4	T	C	5: 137,762,644	V109A	possibly damaging	Het
Ttl	G	A	2: 129,068,915	R73H	probably damaging	Het
Usp34	C	T	11: 23,367,491	T850I	possibly damaging	Het
Vdac3	T	C	8: 22,580,475	Y140C	probably damaging	Het
Vmn2r120	T	C	17: 57,536,659	R62G	probably benign	Het
Vmn2r17	T	A	5: 109,429,465	Y461N	probably damaging	Het
Wt1	T	A	2: 105,172,267	F493I	probably damaging	Het

Other mutations in Epha4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01315:Epha4	APN	1	77398557	missense	probably benign	0.00
IGL01350:Epha4	APN	1	77506855	missense	probably damaging	1.00
IGL01657:Epha4	APN	1	77426838	missense	probably damaging	1.00
IGL01872:Epha4	APN	1	77383039	missense	probably benign	0.03
IGL02366:Epha4	APN	1	77426711	nonsense	probably null
IGL02426:Epha4	APN	1	77444877	missense	probably benign	0.01
IGL02428:Epha4	APN	1	77506748	missense	possibly damaging	0.94
IGL02706:Epha4	APN	1	77426845	missense	probably damaging	1.00
IGL02716:Epha4	APN	1	77380965	missense	probably damaging	1.00
IGL03348:Epha4	APN	1	77507172	missense	possibly damaging	0.82
frog	UTSW	1	77481076	intron	probably benign
R0324:Epha4	UTSW	1	77383551	missense	probably damaging	1.00
R0392:Epha4	UTSW	1	77506973	missense	probably benign	0.00
R0538:Epha4	UTSW	1	77388541	missense	probably damaging	1.00
R0562:Epha4	UTSW	1	77388487	missense	probably benign	0.00
R0885:Epha4	UTSW	1	77382939	missense	probably damaging	0.99
R1509:Epha4	UTSW	1	77380886	missense	probably damaging	1.00
R1620:Epha4	UTSW	1	77374926	missense	probably benign	0.31
R1624:Epha4	UTSW	1	77399692	missense	probably damaging	1.00
R1654:Epha4	UTSW	1	77374768	splice site	probably null
R1755:Epha4	UTSW	1	77387823	missense	probably damaging	1.00
R1807:Epha4	UTSW	1	77374904	missense	probably benign	0.05
R2046:Epha4	UTSW	1	77507162	missense	probably damaging	1.00
R2504:Epha4	UTSW	1	77382991	missense	probably damaging	1.00
R2509:Epha4	UTSW	1	77511702	missense	possibly damaging	0.84
R2511:Epha4	UTSW	1	77511702	missense	possibly damaging	0.84
R3441:Epha4	UTSW	1	77426696	missense	possibly damaging	0.90
R3724:Epha4	UTSW	1	77426543	splice site	probably benign
R3901:Epha4	UTSW	1	77380902	missense	probably damaging	1.00
R3950:Epha4	UTSW	1	77399716	missense	probably damaging	1.00
R3951:Epha4	UTSW	1	77399716	missense	probably damaging	1.00
R3952:Epha4	UTSW	1	77399716	missense	probably damaging	1.00
R4012:Epha4	UTSW	1	77390094	splice site	probably benign
R4321:Epha4	UTSW	1	77507213	critical splice acceptor site	probably null
R4422:Epha4	UTSW	1	77511717	missense	probably damaging	0.99
R4898:Epha4	UTSW	1	77390075	nonsense	probably null
R5072:Epha4	UTSW	1	77445002	missense	probably damaging	1.00
R5270:Epha4	UTSW	1	77506607	missense	probably damaging	1.00
R5281:Epha4	UTSW	1	77374867	missense	probably benign
R5315:Epha4	UTSW	1	77388472	critical splice donor site	probably null
R5531:Epha4	UTSW	1	77374876	missense	probably benign
R5621:Epha4	UTSW	1	77515049	utr 5 prime	probably benign
R5648:Epha4	UTSW	1	77398525	missense	probably benign	0.25
R5747:Epha4	UTSW	1	77506883	missense	probably damaging	0.99
R5829:Epha4	UTSW	1	77444994	missense	probably benign	0.01
R6185:Epha4	UTSW	1	77507106	missense	probably damaging	1.00
R6486:Epha4	UTSW	1	77383549	missense	probably damaging	1.00
R6978:Epha4	UTSW	1	77377583	missense	probably damaging	1.00
R7039:Epha4	UTSW	1	77506785	missense	probably damaging	1.00
R7216:Epha4	UTSW	1	77444984	missense	probably damaging	1.00
R7270:Epha4	UTSW	1	77399785	missense	probably damaging	1.00
R7444:Epha4	UTSW	1	77387916	missense	probably damaging	1.00
R7737:Epha4	UTSW	1	77381012	missense	probably damaging	1.00
R7763:Epha4	UTSW	1	77390031	critical splice donor site	probably null
R7950:Epha4	UTSW	1	77507196	missense	probably damaging	0.99
R8297:Epha4	UTSW	1	77506910	missense	probably damaging	1.00
R8373:Epha4	UTSW	1	77507079	missense	possibly damaging	0.60
R8429:Epha4	UTSW	1	77390036	missense	probably benign	0.08
Z1088:Epha4	UTSW	1	77506662	missense	possibly damaging	0.61
Z1176:Epha4	UTSW	1	77373733	makesense	probably null
Z1176:Epha4	UTSW	1	77383011	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTCACCCATTAGAGTTGGC -3'
(R):5'- CTGATGTTAATGGGACCGTTCC -3'

Sequencing Primer
(F):5'- CACCCATTAGAGTTGGCTTCAAATC -3'
(R):5'- CCACTCTCTTCCTCTGCAGAAG -3'

Posted On

2018-10-18