Incidental Mutation 'R6821:Ccnt2'
ID537597
Institutional Source Beutler Lab
Gene Symbol Ccnt2
Ensembl Gene ENSMUSG00000026349
Gene Namecyclin T2
Synonyms2900041I18Rik, CycT2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6821 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location127774164-127808061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127803335 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 650 (S650P)
Ref Sequence ENSEMBL: ENSMUSP00000027587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027587] [ENSMUST00000112570]
Predicted Effect probably damaging
Transcript: ENSMUST00000027587
AA Change: S650P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027587
Gene: ENSMUSG00000026349
AA Change: S650P

DomainStartEndE-ValueType
CYCLIN 42 141 4.27e-14 SMART
CYCLIN 154 242 4.51e0 SMART
low complexity region 531 543 N/A INTRINSIC
low complexity region 621 653 N/A INTRINSIC
low complexity region 658 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112570
SMART Domains Protein: ENSMUSP00000108189
Gene: ENSMUSG00000026349

DomainStartEndE-ValueType
CYCLIN 42 141 4.27e-14 SMART
CYCLIN 154 242 4.51e0 SMART
low complexity region 531 543 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
Meta Mutation Damage Score 0.1028 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin and its kinase partner CDK9 were found to be subunits of the transcription elongation factor p-TEFb. The p-TEFb complex containing this cyclin was reported to interact with, and act as a negative regulator of human immunodeficiency virus type 1 (HIV-1) Tat protein. A pseudogene of this gene is found on chromosome 1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to the 4-cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,288,836 I417T probably benign Het
Adamts12 A C 15: 11,152,048 K208T probably benign Het
Adamts8 T A 9: 30,956,626 L582Q probably benign Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Ano9 A T 7: 141,107,256 F357I possibly damaging Het
Aox3 T C 1: 58,150,388 V416A probably benign Het
Arhgap21 A C 2: 20,848,848 F1901C probably benign Het
Atp8b2 A T 3: 89,948,173 F506I probably damaging Het
Atp9b A T 18: 80,847,248 L292H probably damaging Het
C2cd5 A G 6: 143,017,986 V891A probably damaging Het
Cdhr3 T A 12: 33,035,045 N791Y probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
D630003M21Rik A C 2: 158,204,774 L761R probably damaging Het
Draxin G T 4: 148,115,691 Q101K possibly damaging Het
Dtx3l A T 16: 35,933,060 L392Q probably damaging Het
Eif3d A G 15: 77,961,655 S389P possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha4 T C 1: 77,382,945 N757S possibly damaging Het
Fam228b T C 12: 4,763,083 I96V probably benign Het
Gars A G 6: 55,079,338 E728G probably benign Het
Gldn T C 9: 54,338,770 M535T probably benign Het
Gm13089 A T 4: 143,699,304 L23* probably null Het
Gm47985 A G 1: 151,183,036 T143A possibly damaging Het
Gpr6 T C 10: 41,071,008 T193A probably benign Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hecw1 T A 13: 14,264,134 Y1315F probably damaging Het
Hs3st2 A G 7: 121,500,522 D197G possibly damaging Het
Igsf9 T C 1: 172,484,493 I2T probably benign Het
Ints9 A G 14: 65,037,458 E621G probably benign Het
Itm2b G A 14: 73,366,467 P47S probably benign Het
Map10 A G 8: 125,670,399 K177R probably benign Het
Mdh2 T C 5: 135,789,671 F260S possibly damaging Het
Mtmr11 A G 3: 96,170,407 T573A probably benign Het
Mycbp2 A T 14: 103,139,409 I3812N probably damaging Het
Myo15 A G 11: 60,524,475 N3403S probably damaging Het
Nvl G A 1: 181,126,970 Q343* probably null Het
Ocstamp A T 2: 165,397,922 S115T probably benign Het
Olfr632 A T 7: 103,937,586 I69F probably benign Het
Otoa G A 7: 121,092,847 probably null Het
Pcdhb20 A T 18: 37,506,122 N567I probably damaging Het
Pgm5 A T 19: 24,861,647 V48E possibly damaging Het
Phlpp1 T A 1: 106,386,444 S1182R probably damaging Het
Pik3r4 T A 9: 105,650,606 L386Q probably damaging Het
Pop1 A G 15: 34,508,639 K287E possibly damaging Het
Rad54b A G 4: 11,612,777 D803G probably damaging Het
Rbm26 G A 14: 105,116,964 probably benign Het
Rspry1 C T 8: 94,635,431 Q113* probably null Het
Siah2 T A 3: 58,691,770 S16C probably benign Het
Sirpa C A 2: 129,630,097 D481E probably damaging Het
Slc38a7 A C 8: 95,844,920 D227E probably benign Het
Smc5 A G 19: 23,242,787 V438A probably benign Het
Spast A G 17: 74,351,962 E108G probably benign Het
Speg A G 1: 75,417,903 E1752G possibly damaging Het
Tanc2 T G 11: 105,886,490 probably null Het
Tgfbi T C 13: 56,626,137 I243T possibly damaging Het
Tlr12 T C 4: 128,616,892 S522G possibly damaging Het
Trav14-3 A G 14: 53,763,472 I47V probably benign Het
Tsc22d4 T C 5: 137,762,644 V109A possibly damaging Het
Ttl G A 2: 129,068,915 R73H probably damaging Het
Usp34 C T 11: 23,367,491 T850I possibly damaging Het
Vdac3 T C 8: 22,580,475 Y140C probably damaging Het
Vmn2r120 T C 17: 57,536,659 R62G probably benign Het
Vmn2r17 T A 5: 109,429,465 Y461N probably damaging Het
Wt1 T A 2: 105,172,267 F493I probably damaging Het
Other mutations in Ccnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ccnt2 APN 1 127797891 splice site probably benign
IGL01370:Ccnt2 APN 1 127803513 missense possibly damaging 0.49
IGL02055:Ccnt2 APN 1 127791710 missense possibly damaging 0.46
IGL02169:Ccnt2 APN 1 127774389 splice site probably benign
R0526:Ccnt2 UTSW 1 127799445 missense probably damaging 1.00
R0538:Ccnt2 UTSW 1 127803165 missense probably damaging 0.98
R0744:Ccnt2 UTSW 1 127802394 missense probably benign 0.42
R0833:Ccnt2 UTSW 1 127802394 missense probably benign 0.42
R0836:Ccnt2 UTSW 1 127802394 missense probably benign 0.42
R1763:Ccnt2 UTSW 1 127799406 missense possibly damaging 0.94
R2037:Ccnt2 UTSW 1 127803399 missense probably damaging 1.00
R2159:Ccnt2 UTSW 1 127775154 missense probably benign 0.00
R4585:Ccnt2 UTSW 1 127803029 missense probably damaging 0.99
R5342:Ccnt2 UTSW 1 127791733 splice site silent
R5527:Ccnt2 UTSW 1 127802664 missense probably benign 0.00
R5698:Ccnt2 UTSW 1 127803228 missense probably benign 0.00
R6606:Ccnt2 UTSW 1 127803241 missense probably benign 0.00
R6979:Ccnt2 UTSW 1 127775136 missense probably damaging 0.97
R7512:Ccnt2 UTSW 1 127802294 missense possibly damaging 0.85
X0019:Ccnt2 UTSW 1 127775140 missense probably damaging 1.00
X0027:Ccnt2 UTSW 1 127774288 missense probably damaging 0.98
Z1177:Ccnt2 UTSW 1 127803058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACAAGTATTTGCACATGC -3'
(R):5'- TGTAGTCCATATGCTGGCTG -3'

Sequencing Primer
(F):5'- ACAGCGGATGGAATGCCTC -3'
(R):5'- CATATGCTGGCTGCTTGTACTGTAC -3'
Posted On2018-10-18