Incidental Mutation 'R6821:Ttl'
ID537604
Institutional Source Beutler Lab
Gene Symbol Ttl
Ensembl Gene ENSMUSG00000027394
Gene Nametubulin tyrosine ligase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6821 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location129065942-129096283 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129068915 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 73 (R73H)
Ref Sequence ENSEMBL: ENSMUSP00000046883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035812]
Predicted Effect probably damaging
Transcript: ENSMUST00000035812
AA Change: R73H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046883
Gene: ENSMUSG00000027394
AA Change: R73H

DomainStartEndE-ValueType
Pfam:TTL 54 367 1.2e-72 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TTL is a cytosolic enzyme involved in the posttranslational modification of alpha-tubulin (see MIM 602529). Alpha-tubulin within assembled microtubules is detyrosinated over time at the C terminus. After microtubule disassembly, TTL restores the tyrosine residues and consequently participates in a cycle of tubulin detyrosination and tyrosination (Erck et al., 2003 [PubMed 14571137]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, impaired breathing, and fail to form the internal capsule in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,288,836 I417T probably benign Het
Adamts12 A C 15: 11,152,048 K208T probably benign Het
Adamts8 T A 9: 30,956,626 L582Q probably benign Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Ano9 A T 7: 141,107,256 F357I possibly damaging Het
Aox3 T C 1: 58,150,388 V416A probably benign Het
Arhgap21 A C 2: 20,848,848 F1901C probably benign Het
Atp8b2 A T 3: 89,948,173 F506I probably damaging Het
Atp9b A T 18: 80,847,248 L292H probably damaging Het
C2cd5 A G 6: 143,017,986 V891A probably damaging Het
Ccnt2 T C 1: 127,803,335 S650P probably damaging Het
Cdhr3 T A 12: 33,035,045 N791Y probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
D630003M21Rik A C 2: 158,204,774 L761R probably damaging Het
Draxin G T 4: 148,115,691 Q101K possibly damaging Het
Dtx3l A T 16: 35,933,060 L392Q probably damaging Het
Eif3d A G 15: 77,961,655 S389P possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha4 T C 1: 77,382,945 N757S possibly damaging Het
Fam228b T C 12: 4,763,083 I96V probably benign Het
Gars A G 6: 55,079,338 E728G probably benign Het
Gldn T C 9: 54,338,770 M535T probably benign Het
Gm13089 A T 4: 143,699,304 L23* probably null Het
Gm47985 A G 1: 151,183,036 T143A possibly damaging Het
Gpr6 T C 10: 41,071,008 T193A probably benign Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hecw1 T A 13: 14,264,134 Y1315F probably damaging Het
Hs3st2 A G 7: 121,500,522 D197G possibly damaging Het
Igsf9 T C 1: 172,484,493 I2T probably benign Het
Ints9 A G 14: 65,037,458 E621G probably benign Het
Itm2b G A 14: 73,366,467 P47S probably benign Het
Map10 A G 8: 125,670,399 K177R probably benign Het
Mdh2 T C 5: 135,789,671 F260S possibly damaging Het
Mtmr11 A G 3: 96,170,407 T573A probably benign Het
Mycbp2 A T 14: 103,139,409 I3812N probably damaging Het
Myo15 A G 11: 60,524,475 N3403S probably damaging Het
Nvl G A 1: 181,126,970 Q343* probably null Het
Ocstamp A T 2: 165,397,922 S115T probably benign Het
Olfr632 A T 7: 103,937,586 I69F probably benign Het
Otoa G A 7: 121,092,847 probably null Het
Pcdhb20 A T 18: 37,506,122 N567I probably damaging Het
Pgm5 A T 19: 24,861,647 V48E possibly damaging Het
Phlpp1 T A 1: 106,386,444 S1182R probably damaging Het
Pik3r4 T A 9: 105,650,606 L386Q probably damaging Het
Pop1 A G 15: 34,508,639 K287E possibly damaging Het
Rad54b A G 4: 11,612,777 D803G probably damaging Het
Rbm26 G A 14: 105,116,964 probably benign Het
Rspry1 C T 8: 94,635,431 Q113* probably null Het
Siah2 T A 3: 58,691,770 S16C probably benign Het
Sirpa C A 2: 129,630,097 D481E probably damaging Het
Slc38a7 A C 8: 95,844,920 D227E probably benign Het
Smc5 A G 19: 23,242,787 V438A probably benign Het
Spast A G 17: 74,351,962 E108G probably benign Het
Speg A G 1: 75,417,903 E1752G possibly damaging Het
Tanc2 T G 11: 105,886,490 probably null Het
Tgfbi T C 13: 56,626,137 I243T possibly damaging Het
Tlr12 T C 4: 128,616,892 S522G possibly damaging Het
Trav14-3 A G 14: 53,763,472 I47V probably benign Het
Tsc22d4 T C 5: 137,762,644 V109A possibly damaging Het
Usp34 C T 11: 23,367,491 T850I possibly damaging Het
Vdac3 T C 8: 22,580,475 Y140C probably damaging Het
Vmn2r120 T C 17: 57,536,659 R62G probably benign Het
Vmn2r17 T A 5: 109,429,465 Y461N probably damaging Het
Wt1 T A 2: 105,172,267 F493I probably damaging Het
Other mutations in Ttl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02742:Ttl APN 2 129066293 missense possibly damaging 0.50
IGL02970:Ttl APN 2 129076070 missense probably damaging 1.00
R0363:Ttl UTSW 2 129076061 missense probably damaging 0.99
R2290:Ttl UTSW 2 129081270 missense possibly damaging 0.69
R3818:Ttl UTSW 2 129092994 missense probably damaging 1.00
R4345:Ttl UTSW 2 129075858 missense probably damaging 1.00
R4471:Ttl UTSW 2 129082057 missense probably benign
R4866:Ttl UTSW 2 129081227 missense probably damaging 1.00
R5269:Ttl UTSW 2 129068911 missense probably damaging 1.00
R5913:Ttl UTSW 2 129076041 missense probably benign
R5941:Ttl UTSW 2 129075984 missense probably benign 0.00
R6287:Ttl UTSW 2 129089121 missense probably damaging 1.00
R6643:Ttl UTSW 2 129081342 missense possibly damaging 0.72
R6883:Ttl UTSW 2 129082072 missense possibly damaging 0.81
R8273:Ttl UTSW 2 129068933 missense probably benign 0.05
R8354:Ttl UTSW 2 129066184 missense probably damaging 1.00
R8403:Ttl UTSW 2 129081243 missense possibly damaging 0.87
R8454:Ttl UTSW 2 129066184 missense probably damaging 1.00
R8817:Ttl UTSW 2 129068858 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATGCTTGACAAACAGCC -3'
(R):5'- TCAAAGCAACTTAGAGGAGGCC -3'

Sequencing Primer
(F):5'- TGCTTGACAAACAGCCTGAAATG -3'
(R):5'- CAACTTAGAGGAGGCCATAGC -3'
Posted On2018-10-18