Incidental Mutation 'R6821:Tlr12'
ID 537612
Institutional Source Beutler Lab
Gene Symbol Tlr12
Ensembl Gene ENSMUSG00000062545
Gene Name toll-like receptor 12
Synonyms LOC384059, Tlr11
MMRRC Submission 044933-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6821 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 128509239-128512412 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128510685 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 522 (S522G)
Ref Sequence ENSEMBL: ENSMUSP00000074381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074829]
AlphaFold Q6QNU9
Predicted Effect possibly damaging
Transcript: ENSMUST00000074829
AA Change: S522G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074381
Gene: ENSMUSG00000062545
AA Change: S522G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 253 266 N/A INTRINSIC
LRR 291 314 1.67e2 SMART
LRR 315 338 9.24e1 SMART
LRR_TYP 341 364 2.79e-4 SMART
LRR 365 388 4.34e-1 SMART
LRR 389 412 1.37e1 SMART
LRR 413 436 1.71e2 SMART
low complexity region 443 459 N/A INTRINSIC
low complexity region 494 502 N/A INTRINSIC
LRR 591 614 5.56e0 SMART
Pfam:TIR 760 905 5.5e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation exhibit a greatly increased susceptibility to kidney infection by uropathogenic bacteria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,277,268 (GRCm39) I417T probably benign Het
Adamts12 A C 15: 11,152,134 (GRCm39) K208T probably benign Het
Adamts8 T A 9: 30,867,922 (GRCm39) L582Q probably benign Het
Aim2 C G 1: 173,291,546 (GRCm39) T317R probably damaging Het
Ano9 A T 7: 140,687,169 (GRCm39) F357I possibly damaging Het
Aox3 T C 1: 58,189,547 (GRCm39) V416A probably benign Het
Arhgap21 A C 2: 20,853,659 (GRCm39) F1901C probably benign Het
Atp8b2 A T 3: 89,855,480 (GRCm39) F506I probably damaging Het
Atp9b A T 18: 80,890,463 (GRCm39) L292H probably damaging Het
C2cd5 A G 6: 142,963,712 (GRCm39) V891A probably damaging Het
Ccnt2 T C 1: 127,731,072 (GRCm39) S650P probably damaging Het
Cdhr3 T A 12: 33,085,044 (GRCm39) N791Y probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 105,036,334 (GRCm39) probably null Het
D630003M21Rik A C 2: 158,046,694 (GRCm39) L761R probably damaging Het
Draxin G T 4: 148,200,148 (GRCm39) Q101K possibly damaging Het
Dtx3l A T 16: 35,753,430 (GRCm39) L392Q probably damaging Het
Eif3d A G 15: 77,845,855 (GRCm39) S389P possibly damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Epha4 T C 1: 77,359,582 (GRCm39) N757S possibly damaging Het
Fam228b T C 12: 4,813,083 (GRCm39) I96V probably benign Het
Gars1 A G 6: 55,056,323 (GRCm39) E728G probably benign Het
Gldn T C 9: 54,246,054 (GRCm39) M535T probably benign Het
Gm47985 A G 1: 151,058,787 (GRCm39) T143A possibly damaging Het
Gpr6 T C 10: 40,947,004 (GRCm39) T193A probably benign Het
Grik5 C T 7: 24,745,780 (GRCm39) R431Q possibly damaging Het
Hecw1 T A 13: 14,438,719 (GRCm39) Y1315F probably damaging Het
Hs3st2 A G 7: 121,099,745 (GRCm39) D197G possibly damaging Het
Igsf9 T C 1: 172,312,060 (GRCm39) I2T probably benign Het
Ints9 A G 14: 65,274,907 (GRCm39) E621G probably benign Het
Itm2b G A 14: 73,603,907 (GRCm39) P47S probably benign Het
Map10 A G 8: 126,397,138 (GRCm39) K177R probably benign Het
Mdh2 T C 5: 135,818,525 (GRCm39) F260S possibly damaging Het
Mtmr11 A G 3: 96,077,723 (GRCm39) T573A probably benign Het
Mycbp2 A T 14: 103,376,845 (GRCm39) I3812N probably damaging Het
Myo15a A G 11: 60,415,301 (GRCm39) N3403S probably damaging Het
Nvl G A 1: 180,954,535 (GRCm39) Q343* probably null Het
Ocstamp A T 2: 165,239,842 (GRCm39) S115T probably benign Het
Or51ai2 A T 7: 103,586,793 (GRCm39) I69F probably benign Het
Otoa G A 7: 120,692,070 (GRCm39) probably null Het
Pcdhb20 A T 18: 37,639,175 (GRCm39) N567I probably damaging Het
Pgm5 A T 19: 24,839,011 (GRCm39) V48E possibly damaging Het
Phlpp1 T A 1: 106,314,174 (GRCm39) S1182R probably damaging Het
Pik3r4 T A 9: 105,527,805 (GRCm39) L386Q probably damaging Het
Pop1 A G 15: 34,508,785 (GRCm39) K287E possibly damaging Het
Pramel23 A T 4: 143,425,874 (GRCm39) L23* probably null Het
Rad54b A G 4: 11,612,777 (GRCm39) D803G probably damaging Het
Rbm26 G A 14: 105,354,400 (GRCm39) probably benign Het
Rspry1 C T 8: 95,362,059 (GRCm39) Q113* probably null Het
Siah2 T A 3: 58,599,191 (GRCm39) S16C probably benign Het
Sirpa C A 2: 129,472,017 (GRCm39) D481E probably damaging Het
Slc38a7 A C 8: 96,571,548 (GRCm39) D227E probably benign Het
Smc5 A G 19: 23,220,151 (GRCm39) V438A probably benign Het
Spast A G 17: 74,658,957 (GRCm39) E108G probably benign Het
Speg A G 1: 75,394,547 (GRCm39) E1752G possibly damaging Het
Tanc2 T G 11: 105,777,316 (GRCm39) probably null Het
Tgfbi T C 13: 56,773,950 (GRCm39) I243T possibly damaging Het
Trav14-3 A G 14: 54,000,929 (GRCm39) I47V probably benign Het
Tsc22d4 T C 5: 137,760,906 (GRCm39) V109A possibly damaging Het
Ttl G A 2: 128,910,835 (GRCm39) R73H probably damaging Het
Usp34 C T 11: 23,317,491 (GRCm39) T850I possibly damaging Het
Vdac3 T C 8: 23,070,491 (GRCm39) Y140C probably damaging Het
Vmn2r120 T C 17: 57,843,659 (GRCm39) R62G probably benign Het
Vmn2r17 T A 5: 109,577,331 (GRCm39) Y461N probably damaging Het
Wt1 T A 2: 105,002,612 (GRCm39) F493I probably damaging Het
Other mutations in Tlr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Tlr12 APN 4 128,511,215 (GRCm39) missense probably benign 0.00
IGL00654:Tlr12 APN 4 128,511,233 (GRCm39) missense probably benign 0.27
IGL01290:Tlr12 APN 4 128,511,630 (GRCm39) missense probably damaging 1.00
IGL01406:Tlr12 APN 4 128,510,132 (GRCm39) nonsense probably null
IGL01550:Tlr12 APN 4 128,509,535 (GRCm39) missense probably damaging 1.00
IGL02590:Tlr12 APN 4 128,511,182 (GRCm39) missense probably benign 0.00
IGL02592:Tlr12 APN 4 128,511,479 (GRCm39) missense probably benign 0.02
IGL02635:Tlr12 APN 4 128,510,609 (GRCm39) missense probably damaging 0.98
IGL02714:Tlr12 APN 4 128,511,506 (GRCm39) missense probably damaging 1.00
IGL03104:Tlr12 APN 4 128,509,685 (GRCm39) missense probably benign 0.01
IGL03131:Tlr12 APN 4 128,509,670 (GRCm39) missense probably damaging 1.00
IGL03329:Tlr12 APN 4 128,510,645 (GRCm39) missense possibly damaging 0.84
IGL03354:Tlr12 APN 4 128,509,730 (GRCm39) missense probably damaging 1.00
R0848:Tlr12 UTSW 4 128,510,084 (GRCm39) missense probably benign 0.05
R1536:Tlr12 UTSW 4 128,511,545 (GRCm39) missense possibly damaging 0.95
R1807:Tlr12 UTSW 4 128,511,229 (GRCm39) missense probably benign 0.21
R1989:Tlr12 UTSW 4 128,510,862 (GRCm39) missense probably benign 0.04
R2905:Tlr12 UTSW 4 128,509,802 (GRCm39) missense probably damaging 1.00
R3870:Tlr12 UTSW 4 128,510,361 (GRCm39) missense probably benign 0.00
R4026:Tlr12 UTSW 4 128,510,301 (GRCm39) missense probably benign 0.00
R4296:Tlr12 UTSW 4 128,511,581 (GRCm39) missense probably damaging 1.00
R4398:Tlr12 UTSW 4 128,509,988 (GRCm39) missense probably benign 0.09
R4528:Tlr12 UTSW 4 128,511,818 (GRCm39) missense probably damaging 1.00
R4559:Tlr12 UTSW 4 128,509,563 (GRCm39) missense probably damaging 1.00
R4599:Tlr12 UTSW 4 128,511,125 (GRCm39) missense probably benign 0.06
R4999:Tlr12 UTSW 4 128,511,473 (GRCm39) missense probably benign 0.38
R5054:Tlr12 UTSW 4 128,511,063 (GRCm39) nonsense probably null
R5177:Tlr12 UTSW 4 128,512,169 (GRCm39) missense probably damaging 0.96
R5207:Tlr12 UTSW 4 128,510,502 (GRCm39) nonsense probably null
R5533:Tlr12 UTSW 4 128,509,656 (GRCm39) missense probably damaging 0.99
R6484:Tlr12 UTSW 4 128,509,847 (GRCm39) missense probably damaging 1.00
R6568:Tlr12 UTSW 4 128,511,785 (GRCm39) missense probably benign 0.10
R7465:Tlr12 UTSW 4 128,509,963 (GRCm39) missense probably damaging 1.00
R7594:Tlr12 UTSW 4 128,511,473 (GRCm39) missense probably benign 0.38
R7810:Tlr12 UTSW 4 128,510,501 (GRCm39) missense probably benign 0.00
R7957:Tlr12 UTSW 4 128,510,483 (GRCm39) missense probably benign 0.33
R8258:Tlr12 UTSW 4 128,511,492 (GRCm39) missense probably benign 0.38
R8259:Tlr12 UTSW 4 128,511,492 (GRCm39) missense probably benign 0.38
R8377:Tlr12 UTSW 4 128,509,566 (GRCm39) missense probably benign
R8422:Tlr12 UTSW 4 128,510,427 (GRCm39) missense probably damaging 1.00
R9098:Tlr12 UTSW 4 128,510,870 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTATGGACTGAAGCGACGC -3'
(R):5'- TGCATACCTTGAGCCTGAAGC -3'

Sequencing Primer
(F):5'- TGAAGCGACGCCAGCTTC -3'
(R):5'- GCCCATGTATCTGACCAGCTTAGAG -3'
Posted On 2018-10-18