Incidental Mutation 'R6821:Gm13089'
ID537613
Institutional Source Beutler Lab
Gene Symbol Gm13089
Ensembl Gene ENSMUSG00000070617
Gene Namepredicted gene 13089
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6821 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location143696500-143702711 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 143699304 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 23 (L23*)
Ref Sequence ENSEMBL: ENSMUSP00000073224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073532]
Predicted Effect probably null
Transcript: ENSMUST00000073532
AA Change: L23*
SMART Domains Protein: ENSMUSP00000073224
Gene: ENSMUSG00000070617
AA Change: L23*

DomainStartEndE-ValueType
low complexity region 204 216 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,288,836 I417T probably benign Het
Adamts12 A C 15: 11,152,048 K208T probably benign Het
Adamts8 T A 9: 30,956,626 L582Q probably benign Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Ano9 A T 7: 141,107,256 F357I possibly damaging Het
Aox3 T C 1: 58,150,388 V416A probably benign Het
Arhgap21 A C 2: 20,848,848 F1901C probably benign Het
Atp8b2 A T 3: 89,948,173 F506I probably damaging Het
Atp9b A T 18: 80,847,248 L292H probably damaging Het
C2cd5 A G 6: 143,017,986 V891A probably damaging Het
Ccnt2 T C 1: 127,803,335 S650P probably damaging Het
Cdhr3 T A 12: 33,035,045 N791Y probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
D630003M21Rik A C 2: 158,204,774 L761R probably damaging Het
Draxin G T 4: 148,115,691 Q101K possibly damaging Het
Dtx3l A T 16: 35,933,060 L392Q probably damaging Het
Eif3d A G 15: 77,961,655 S389P possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha4 T C 1: 77,382,945 N757S possibly damaging Het
Fam228b T C 12: 4,763,083 I96V probably benign Het
Gars A G 6: 55,079,338 E728G probably benign Het
Gldn T C 9: 54,338,770 M535T probably benign Het
Gm47985 A G 1: 151,183,036 T143A possibly damaging Het
Gpr6 T C 10: 41,071,008 T193A probably benign Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hecw1 T A 13: 14,264,134 Y1315F probably damaging Het
Hs3st2 A G 7: 121,500,522 D197G possibly damaging Het
Igsf9 T C 1: 172,484,493 I2T probably benign Het
Ints9 A G 14: 65,037,458 E621G probably benign Het
Itm2b G A 14: 73,366,467 P47S probably benign Het
Map10 A G 8: 125,670,399 K177R probably benign Het
Mdh2 T C 5: 135,789,671 F260S possibly damaging Het
Mtmr11 A G 3: 96,170,407 T573A probably benign Het
Mycbp2 A T 14: 103,139,409 I3812N probably damaging Het
Myo15 A G 11: 60,524,475 N3403S probably damaging Het
Nvl G A 1: 181,126,970 Q343* probably null Het
Ocstamp A T 2: 165,397,922 S115T probably benign Het
Olfr632 A T 7: 103,937,586 I69F probably benign Het
Otoa G A 7: 121,092,847 probably null Het
Pcdhb20 A T 18: 37,506,122 N567I probably damaging Het
Pgm5 A T 19: 24,861,647 V48E possibly damaging Het
Phlpp1 T A 1: 106,386,444 S1182R probably damaging Het
Pik3r4 T A 9: 105,650,606 L386Q probably damaging Het
Pop1 A G 15: 34,508,639 K287E possibly damaging Het
Rad54b A G 4: 11,612,777 D803G probably damaging Het
Rbm26 G A 14: 105,116,964 probably benign Het
Rspry1 C T 8: 94,635,431 Q113* probably null Het
Siah2 T A 3: 58,691,770 S16C probably benign Het
Sirpa C A 2: 129,630,097 D481E probably damaging Het
Slc38a7 A C 8: 95,844,920 D227E probably benign Het
Smc5 A G 19: 23,242,787 V438A probably benign Het
Spast A G 17: 74,351,962 E108G probably benign Het
Speg A G 1: 75,417,903 E1752G possibly damaging Het
Tanc2 T G 11: 105,886,490 probably null Het
Tgfbi T C 13: 56,626,137 I243T possibly damaging Het
Tlr12 T C 4: 128,616,892 S522G possibly damaging Het
Trav14-3 A G 14: 53,763,472 I47V probably benign Het
Tsc22d4 T C 5: 137,762,644 V109A possibly damaging Het
Ttl G A 2: 129,068,915 R73H probably damaging Het
Usp34 C T 11: 23,367,491 T850I possibly damaging Het
Vdac3 T C 8: 22,580,475 Y140C probably damaging Het
Vmn2r120 T C 17: 57,536,659 R62G probably benign Het
Vmn2r17 T A 5: 109,429,465 Y461N probably damaging Het
Wt1 T A 2: 105,172,267 F493I probably damaging Het
Other mutations in Gm13089
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Gm13089 APN 4 143696840 utr 3 prime probably benign
IGL02087:Gm13089 APN 4 143697074 missense probably damaging 0.96
IGL02296:Gm13089 APN 4 143698481 nonsense probably null
IGL02902:Gm13089 APN 4 143698343 missense probably damaging 1.00
IGL02903:Gm13089 APN 4 143699166 missense probably benign 0.04
IGL02962:Gm13089 APN 4 143697340 missense probably benign 0.28
IGL03351:Gm13089 APN 4 143697088 missense possibly damaging 0.80
R0122:Gm13089 UTSW 4 143698404 missense probably benign 0.44
R0533:Gm13089 UTSW 4 143698020 nonsense probably null
R0609:Gm13089 UTSW 4 143698503 missense probably benign 0.00
R0743:Gm13089 UTSW 4 143698564 missense probably damaging 0.97
R0744:Gm13089 UTSW 4 143698486 missense probably benign 0.19
R0833:Gm13089 UTSW 4 143698486 missense probably benign 0.19
R1052:Gm13089 UTSW 4 143696907 missense possibly damaging 0.81
R1690:Gm13089 UTSW 4 143698123 missense probably benign 0.03
R1764:Gm13089 UTSW 4 143698270 missense probably benign 0.14
R1896:Gm13089 UTSW 4 143698144 missense probably benign 0.11
R2084:Gm13089 UTSW 4 143699350 missense probably damaging 1.00
R2178:Gm13089 UTSW 4 143698042 missense possibly damaging 0.95
R2888:Gm13089 UTSW 4 143696890 missense probably benign 0.00
R3759:Gm13089 UTSW 4 143697151 missense probably damaging 1.00
R4193:Gm13089 UTSW 4 143698333 missense probably damaging 1.00
R4380:Gm13089 UTSW 4 143698286 missense probably benign 0.21
R4385:Gm13089 UTSW 4 143698014 critical splice donor site probably null
R4513:Gm13089 UTSW 4 143698148 missense probably benign 0.00
R4647:Gm13089 UTSW 4 143699344 missense probably benign 0.00
R4920:Gm13089 UTSW 4 143699283 missense probably benign 0.05
R4994:Gm13089 UTSW 4 143698369 missense possibly damaging 0.94
R5197:Gm13089 UTSW 4 143698062 missense possibly damaging 0.86
R6005:Gm13089 UTSW 4 143698432 missense probably benign 0.00
R6073:Gm13089 UTSW 4 143698268 missense probably damaging 0.99
R6197:Gm13089 UTSW 4 143697316 missense possibly damaging 0.90
R6264:Gm13089 UTSW 4 143699152 missense possibly damaging 0.50
R6923:Gm13089 UTSW 4 143699106 missense probably benign 0.06
R7034:Gm13089 UTSW 4 143697328 missense probably damaging 1.00
R7140:Gm13089 UTSW 4 143698432 missense probably benign 0.01
R7298:Gm13089 UTSW 4 143698505 missense probably benign 0.23
R7529:Gm13089 UTSW 4 143702674
R7766:Gm13089 UTSW 4 143699239 missense probably damaging 0.98
R7774:Gm13089 UTSW 4 143697106 missense possibly damaging 0.89
R7816:Gm13089 UTSW 4 143698194 missense probably benign 0.00
Z1088:Gm13089 UTSW 4 143698080 missense probably benign
Z1176:Gm13089 UTSW 4 143696945 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGGAATGCACCACTTTTG -3'
(R):5'- AGTAATCTAGCCCTCATACGTCC -3'

Sequencing Primer
(F):5'- ATCTATTTCCTGAAGAACAGCCTTC -3'
(R):5'- CCTGAGTGGACCAAAAGGCTTC -3'
Posted On2018-10-18