Incidental Mutation 'R6821:Vmn2r17'
ID537615
Institutional Source Beutler Lab
Gene Symbol Vmn2r17
Ensembl Gene ENSMUSG00000091879
Gene Namevomeronasal 2, receptor 17
SynonymsEG384221
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6821 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location109420013-109453387 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109429465 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 461 (Y461N)
Ref Sequence ENSEMBL: ENSMUSP00000131450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171841]
Predicted Effect probably damaging
Transcript: ENSMUST00000171841
AA Change: Y461N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131450
Gene: ENSMUSG00000091879
AA Change: Y461N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 465 7e-26 PFAM
Pfam:NCD3G 508 562 3.5e-18 PFAM
Pfam:7tm_3 593 830 4.8e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,288,836 I417T probably benign Het
Adamts12 A C 15: 11,152,048 K208T probably benign Het
Adamts8 T A 9: 30,956,626 L582Q probably benign Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Ano9 A T 7: 141,107,256 F357I possibly damaging Het
Aox3 T C 1: 58,150,388 V416A probably benign Het
Arhgap21 A C 2: 20,848,848 F1901C probably benign Het
Atp8b2 A T 3: 89,948,173 F506I probably damaging Het
Atp9b A T 18: 80,847,248 L292H probably damaging Het
C2cd5 A G 6: 143,017,986 V891A probably damaging Het
Ccnt2 T C 1: 127,803,335 S650P probably damaging Het
Cdhr3 T A 12: 33,035,045 N791Y probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
D630003M21Rik A C 2: 158,204,774 L761R probably damaging Het
Draxin G T 4: 148,115,691 Q101K possibly damaging Het
Dtx3l A T 16: 35,933,060 L392Q probably damaging Het
Eif3d A G 15: 77,961,655 S389P possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha4 T C 1: 77,382,945 N757S possibly damaging Het
Fam228b T C 12: 4,763,083 I96V probably benign Het
Gars A G 6: 55,079,338 E728G probably benign Het
Gldn T C 9: 54,338,770 M535T probably benign Het
Gm13089 A T 4: 143,699,304 L23* probably null Het
Gm47985 A G 1: 151,183,036 T143A possibly damaging Het
Gpr6 T C 10: 41,071,008 T193A probably benign Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hecw1 T A 13: 14,264,134 Y1315F probably damaging Het
Hs3st2 A G 7: 121,500,522 D197G possibly damaging Het
Igsf9 T C 1: 172,484,493 I2T probably benign Het
Ints9 A G 14: 65,037,458 E621G probably benign Het
Itm2b G A 14: 73,366,467 P47S probably benign Het
Map10 A G 8: 125,670,399 K177R probably benign Het
Mdh2 T C 5: 135,789,671 F260S possibly damaging Het
Mtmr11 A G 3: 96,170,407 T573A probably benign Het
Mycbp2 A T 14: 103,139,409 I3812N probably damaging Het
Myo15 A G 11: 60,524,475 N3403S probably damaging Het
Nvl G A 1: 181,126,970 Q343* probably null Het
Ocstamp A T 2: 165,397,922 S115T probably benign Het
Olfr632 A T 7: 103,937,586 I69F probably benign Het
Otoa G A 7: 121,092,847 probably null Het
Pcdhb20 A T 18: 37,506,122 N567I probably damaging Het
Pgm5 A T 19: 24,861,647 V48E possibly damaging Het
Phlpp1 T A 1: 106,386,444 S1182R probably damaging Het
Pik3r4 T A 9: 105,650,606 L386Q probably damaging Het
Pop1 A G 15: 34,508,639 K287E possibly damaging Het
Rad54b A G 4: 11,612,777 D803G probably damaging Het
Rbm26 G A 14: 105,116,964 probably benign Het
Rspry1 C T 8: 94,635,431 Q113* probably null Het
Siah2 T A 3: 58,691,770 S16C probably benign Het
Sirpa C A 2: 129,630,097 D481E probably damaging Het
Slc38a7 A C 8: 95,844,920 D227E probably benign Het
Smc5 A G 19: 23,242,787 V438A probably benign Het
Spast A G 17: 74,351,962 E108G probably benign Het
Speg A G 1: 75,417,903 E1752G possibly damaging Het
Tanc2 T G 11: 105,886,490 probably null Het
Tgfbi T C 13: 56,626,137 I243T possibly damaging Het
Tlr12 T C 4: 128,616,892 S522G possibly damaging Het
Trav14-3 A G 14: 53,763,472 I47V probably benign Het
Tsc22d4 T C 5: 137,762,644 V109A possibly damaging Het
Ttl G A 2: 129,068,915 R73H probably damaging Het
Usp34 C T 11: 23,367,491 T850I possibly damaging Het
Vdac3 T C 8: 22,580,475 Y140C probably damaging Het
Vmn2r120 T C 17: 57,536,659 R62G probably benign Het
Wt1 T A 2: 105,172,267 F493I probably damaging Het
Other mutations in Vmn2r17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Vmn2r17 APN 5 109427992 missense probably benign 0.15
IGL01457:Vmn2r17 APN 5 109453032 missense probably benign 0.00
IGL01527:Vmn2r17 APN 5 109453140 missense probably damaging 1.00
IGL01693:Vmn2r17 APN 5 109452518 missense probably damaging 1.00
IGL01738:Vmn2r17 APN 5 109429498 missense probably damaging 1.00
IGL01767:Vmn2r17 APN 5 109420037 missense probably benign 0.01
IGL01932:Vmn2r17 APN 5 109427050 missense probably benign 0.00
IGL01970:Vmn2r17 APN 5 109427947 missense probably damaging 0.97
IGL02009:Vmn2r17 APN 5 109452848 missense possibly damaging 0.67
IGL02365:Vmn2r17 APN 5 109453309 missense probably damaging 1.00
IGL02385:Vmn2r17 APN 5 109434381 missense probably damaging 1.00
IGL02457:Vmn2r17 APN 5 109453146 missense probably damaging 1.00
IGL02646:Vmn2r17 APN 5 109453080 missense probably damaging 1.00
IGL02741:Vmn2r17 APN 5 109420211 missense probably benign
IGL03213:Vmn2r17 APN 5 109434390 critical splice donor site probably null
IGL03216:Vmn2r17 APN 5 109452890 missense probably damaging 1.00
IGL03342:Vmn2r17 APN 5 109427916 missense probably damaging 1.00
IGL03408:Vmn2r17 APN 5 109429372 splice site probably benign
R0349:Vmn2r17 UTSW 5 109428336 missense probably damaging 1.00
R0418:Vmn2r17 UTSW 5 109452881 missense probably damaging 1.00
R0800:Vmn2r17 UTSW 5 109427326 splice site probably benign
R0836:Vmn2r17 UTSW 5 109427956 missense possibly damaging 0.89
R1715:Vmn2r17 UTSW 5 109428244 missense probably benign 0.00
R1738:Vmn2r17 UTSW 5 109428511 missense probably benign 0.10
R1801:Vmn2r17 UTSW 5 109428478 missense probably damaging 1.00
R2054:Vmn2r17 UTSW 5 109452486 missense probably damaging 0.98
R2060:Vmn2r17 UTSW 5 109427209 missense probably benign 0.00
R2192:Vmn2r17 UTSW 5 109434278 missense possibly damaging 0.81
R2315:Vmn2r17 UTSW 5 109428031 missense probably damaging 1.00
R2374:Vmn2r17 UTSW 5 109427238 missense probably benign
R3612:Vmn2r17 UTSW 5 109429597 missense probably benign 0.00
R3832:Vmn2r17 UTSW 5 109428396 missense probably damaging 1.00
R4273:Vmn2r17 UTSW 5 109452966 missense probably benign 0.44
R4494:Vmn2r17 UTSW 5 109428469 missense probably damaging 1.00
R4597:Vmn2r17 UTSW 5 109429562 missense probably benign 0.01
R4675:Vmn2r17 UTSW 5 109427183 missense probably benign 0.00
R4701:Vmn2r17 UTSW 5 109427983 missense probably damaging 0.99
R4754:Vmn2r17 UTSW 5 109452849 missense probably damaging 0.99
R4841:Vmn2r17 UTSW 5 109434380 missense probably damaging 1.00
R4842:Vmn2r17 UTSW 5 109434380 missense probably damaging 1.00
R4865:Vmn2r17 UTSW 5 109427119 missense probably damaging 1.00
R4902:Vmn2r17 UTSW 5 109453354 missense probably benign 0.14
R4989:Vmn2r17 UTSW 5 109427873 missense probably benign 0.07
R5101:Vmn2r17 UTSW 5 109428351 missense probably damaging 0.99
R5109:Vmn2r17 UTSW 5 109429476 missense probably benign 0.06
R5123:Vmn2r17 UTSW 5 109427908 missense possibly damaging 0.90
R5474:Vmn2r17 UTSW 5 109434284 missense probably damaging 1.00
R5485:Vmn2r17 UTSW 5 109420106 missense probably benign 0.06
R5611:Vmn2r17 UTSW 5 109428164 missense probably damaging 0.97
R5652:Vmn2r17 UTSW 5 109429564 missense probably benign 0.10
R5717:Vmn2r17 UTSW 5 109427274 missense possibly damaging 0.94
R5735:Vmn2r17 UTSW 5 109452850 missense possibly damaging 0.67
R5766:Vmn2r17 UTSW 5 109427273 missense possibly damaging 0.46
R6645:Vmn2r17 UTSW 5 109428381 missense probably damaging 1.00
R6786:Vmn2r17 UTSW 5 109427829 missense probably benign 0.30
R6979:Vmn2r17 UTSW 5 109428399 missense possibly damaging 0.46
R6984:Vmn2r17 UTSW 5 109452667 missense probably benign 0.10
R7269:Vmn2r17 UTSW 5 109428471 missense possibly damaging 0.88
R7509:Vmn2r17 UTSW 5 109427829 missense probably benign 0.30
R7736:Vmn2r17 UTSW 5 109452891 missense probably benign 0.05
R7789:Vmn2r17 UTSW 5 109452965 missense possibly damaging 0.77
R7814:Vmn2r17 UTSW 5 109427873 missense probably benign 0.07
R7847:Vmn2r17 UTSW 5 109420197 missense probably damaging 1.00
R7863:Vmn2r17 UTSW 5 109420169 missense probably benign
R7893:Vmn2r17 UTSW 5 109428078 missense probably benign 0.05
R8234:Vmn2r17 UTSW 5 109453369 missense probably benign 0.01
R8382:Vmn2r17 UTSW 5 109428521 missense probably benign 0.01
R8435:Vmn2r17 UTSW 5 109428306 missense probably benign 0.01
R8465:Vmn2r17 UTSW 5 109452825 missense probably damaging 0.99
R8555:Vmn2r17 UTSW 5 109452944 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGTCTTTCCTGGAAACCATTG -3'
(R):5'- AATCACACAGCTACATCTTTTGTGC -3'

Sequencing Primer
(F):5'- TCCTGGAAACCATTGAAGAATTAGG -3'
(R):5'- TGGCCCACTCCAAATCT -3'
Posted On2018-10-18