Incidental Mutation 'R6821:Mdh2'
ID537616
Institutional Source Beutler Lab
Gene Symbol Mdh2
Ensembl Gene ENSMUSG00000019179
Gene Namemalate dehydrogenase 2, NAD (mitochondrial)
SynonymsMor-1, Mor1, Mdh-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6821 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location135778480-135790398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135789671 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 260 (F260S)
Ref Sequence ENSEMBL: ENSMUSP00000019323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019323] [ENSMUST00000138101] [ENSMUST00000196285] [ENSMUST00000200556]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019323
AA Change: F260S

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000019323
Gene: ENSMUSG00000019179
AA Change: F260S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Ldh_1_N 25 168 7.2e-50 PFAM
Pfam:Ldh_1_C 170 334 4.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138101
SMART Domains Protein: ENSMUSP00000136225
Gene: ENSMUSG00000019179

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196285
SMART Domains Protein: ENSMUSP00000143748
Gene: ENSMUSG00000019179

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Ldh_1_N 25 79 9.5e-14 PFAM
Pfam:Ldh_1_N 74 140 8.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200556
SMART Domains Protein: ENSMUSP00000142993
Gene: ENSMUSG00000019179

DomainStartEndE-ValueType
Pfam:Ldh_1_N 9 145 1.7e-39 PFAM
Pfam:Ldh_1_C 147 198 3.8e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Malate dehydrogenase catalyzes the reversible oxidation of malate to oxaloacetate, utilizing the NAD/NADH cofactor system in the citric acid cycle. The protein encoded by this gene is localized to the mitochondria and may play pivotal roles in the malate-aspartate shuttle that operates in the metabolic coordination between cytosol and mitochondria. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,288,836 I417T probably benign Het
Adamts12 A C 15: 11,152,048 K208T probably benign Het
Adamts8 T A 9: 30,956,626 L582Q probably benign Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Ano9 A T 7: 141,107,256 F357I possibly damaging Het
Aox3 T C 1: 58,150,388 V416A probably benign Het
Arhgap21 A C 2: 20,848,848 F1901C probably benign Het
Atp8b2 A T 3: 89,948,173 F506I probably damaging Het
Atp9b A T 18: 80,847,248 L292H probably damaging Het
C2cd5 A G 6: 143,017,986 V891A probably damaging Het
Ccnt2 T C 1: 127,803,335 S650P probably damaging Het
Cdhr3 T A 12: 33,035,045 N791Y probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
D630003M21Rik A C 2: 158,204,774 L761R probably damaging Het
Draxin G T 4: 148,115,691 Q101K possibly damaging Het
Dtx3l A T 16: 35,933,060 L392Q probably damaging Het
Eif3d A G 15: 77,961,655 S389P possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha4 T C 1: 77,382,945 N757S possibly damaging Het
Fam228b T C 12: 4,763,083 I96V probably benign Het
Gars A G 6: 55,079,338 E728G probably benign Het
Gldn T C 9: 54,338,770 M535T probably benign Het
Gm13089 A T 4: 143,699,304 L23* probably null Het
Gm47985 A G 1: 151,183,036 T143A possibly damaging Het
Gpr6 T C 10: 41,071,008 T193A probably benign Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hecw1 T A 13: 14,264,134 Y1315F probably damaging Het
Hs3st2 A G 7: 121,500,522 D197G possibly damaging Het
Igsf9 T C 1: 172,484,493 I2T probably benign Het
Ints9 A G 14: 65,037,458 E621G probably benign Het
Itm2b G A 14: 73,366,467 P47S probably benign Het
Map10 A G 8: 125,670,399 K177R probably benign Het
Mtmr11 A G 3: 96,170,407 T573A probably benign Het
Mycbp2 A T 14: 103,139,409 I3812N probably damaging Het
Myo15 A G 11: 60,524,475 N3403S probably damaging Het
Nvl G A 1: 181,126,970 Q343* probably null Het
Ocstamp A T 2: 165,397,922 S115T probably benign Het
Olfr632 A T 7: 103,937,586 I69F probably benign Het
Otoa G A 7: 121,092,847 probably null Het
Pcdhb20 A T 18: 37,506,122 N567I probably damaging Het
Pgm5 A T 19: 24,861,647 V48E possibly damaging Het
Phlpp1 T A 1: 106,386,444 S1182R probably damaging Het
Pik3r4 T A 9: 105,650,606 L386Q probably damaging Het
Pop1 A G 15: 34,508,639 K287E possibly damaging Het
Rad54b A G 4: 11,612,777 D803G probably damaging Het
Rbm26 G A 14: 105,116,964 probably benign Het
Rspry1 C T 8: 94,635,431 Q113* probably null Het
Siah2 T A 3: 58,691,770 S16C probably benign Het
Sirpa C A 2: 129,630,097 D481E probably damaging Het
Slc38a7 A C 8: 95,844,920 D227E probably benign Het
Smc5 A G 19: 23,242,787 V438A probably benign Het
Spast A G 17: 74,351,962 E108G probably benign Het
Speg A G 1: 75,417,903 E1752G possibly damaging Het
Tanc2 T G 11: 105,886,490 probably null Het
Tgfbi T C 13: 56,626,137 I243T possibly damaging Het
Tlr12 T C 4: 128,616,892 S522G possibly damaging Het
Trav14-3 A G 14: 53,763,472 I47V probably benign Het
Tsc22d4 T C 5: 137,762,644 V109A possibly damaging Het
Ttl G A 2: 129,068,915 R73H probably damaging Het
Usp34 C T 11: 23,367,491 T850I possibly damaging Het
Vdac3 T C 8: 22,580,475 Y140C probably damaging Het
Vmn2r120 T C 17: 57,536,659 R62G probably benign Het
Vmn2r17 T A 5: 109,429,465 Y461N probably damaging Het
Wt1 T A 2: 105,172,267 F493I probably damaging Het
Other mutations in Mdh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mdh2 APN 5 135786284 missense probably damaging 1.00
IGL01413:Mdh2 APN 5 135786025 missense probably damaging 0.99
IGL01418:Mdh2 APN 5 135786025 missense probably damaging 0.99
IGL03290:Mdh2 APN 5 135789713 missense probably damaging 1.00
R0396:Mdh2 UTSW 5 135789679 missense probably benign
R0492:Mdh2 UTSW 5 135790150 missense possibly damaging 0.54
R4977:Mdh2 UTSW 5 135783409 missense probably damaging 1.00
R5162:Mdh2 UTSW 5 135783475 critical splice donor site probably null
R5839:Mdh2 UTSW 5 135783292 splice site probably null
R8690:Mdh2 UTSW 5 135786028 missense probably benign 0.39
Z1176:Mdh2 UTSW 5 135789629 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGAGACAGTGAAGTGCG -3'
(R):5'- GTTCACAGCTGCCACATTCC -3'

Sequencing Primer
(F):5'- GGAAGTGCAGCCCAGAATACC -3'
(R):5'- ACAGCTCTGCTCTAAGTGACATTG -3'
Posted On2018-10-18