Incidental Mutation 'R6821:Tsc22d4'
ID537617
Institutional Source Beutler Lab
Gene Symbol Tsc22d4
Ensembl Gene ENSMUSG00000029723
Gene NameTSC22 domain family, member 4
Synonyms0610009M14Rik, 1700023B23Rik, Thg-1pit
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6821 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location137745730-137768450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137762644 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 109 (V109A)
Ref Sequence ENSEMBL: ENSMUSP00000106611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031738] [ENSMUST00000100539] [ENSMUST00000100540] [ENSMUST00000110983] [ENSMUST00000110985] [ENSMUST00000141733]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031738
AA Change: V109A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031738
Gene: ENSMUSG00000029723
AA Change: V109A

DomainStartEndE-ValueType
low complexity region 89 104 N/A INTRINSIC
low complexity region 167 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100539
SMART Domains Protein: ENSMUSP00000098107
Gene: ENSMUSG00000029723

DomainStartEndE-ValueType
low complexity region 31 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 190 199 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
Pfam:TSC22 318 377 5.9e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100540
AA Change: V408A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098108
Gene: ENSMUSG00000029723
AA Change: V408A

DomainStartEndE-ValueType
low complexity region 31 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 190 199 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
Pfam:DUF4703 319 509 4.5e-82 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110983
AA Change: V109A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106611
Gene: ENSMUSG00000029723
AA Change: V109A

DomainStartEndE-ValueType
Pfam:DUF4703 20 136 1.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110985
SMART Domains Protein: ENSMUSP00000106613
Gene: ENSMUSG00000029723

DomainStartEndE-ValueType
Pfam:TSC22 99 158 9.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141733
SMART Domains Protein: ENSMUSP00000120835
Gene: ENSMUSG00000029723

DomainStartEndE-ValueType
Pfam:TSC22 27 82 6.6e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TSC22D4 is a member of the TSC22 domain family of leucine zipper transcriptional regulators (see TSC22D3; MIM 300506) (Kester et al., 1999 [PubMed 10488076]; Fiorenza et al., 2001 [PubMed 11707329]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,288,836 I417T probably benign Het
Adamts12 A C 15: 11,152,048 K208T probably benign Het
Adamts8 T A 9: 30,956,626 L582Q probably benign Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Ano9 A T 7: 141,107,256 F357I possibly damaging Het
Aox3 T C 1: 58,150,388 V416A probably benign Het
Arhgap21 A C 2: 20,848,848 F1901C probably benign Het
Atp8b2 A T 3: 89,948,173 F506I probably damaging Het
Atp9b A T 18: 80,847,248 L292H probably damaging Het
C2cd5 A G 6: 143,017,986 V891A probably damaging Het
Ccnt2 T C 1: 127,803,335 S650P probably damaging Het
Cdhr3 T A 12: 33,035,045 N791Y probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
D630003M21Rik A C 2: 158,204,774 L761R probably damaging Het
Draxin G T 4: 148,115,691 Q101K possibly damaging Het
Dtx3l A T 16: 35,933,060 L392Q probably damaging Het
Eif3d A G 15: 77,961,655 S389P possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha4 T C 1: 77,382,945 N757S possibly damaging Het
Fam228b T C 12: 4,763,083 I96V probably benign Het
Gars A G 6: 55,079,338 E728G probably benign Het
Gldn T C 9: 54,338,770 M535T probably benign Het
Gm13089 A T 4: 143,699,304 L23* probably null Het
Gm47985 A G 1: 151,183,036 T143A possibly damaging Het
Gpr6 T C 10: 41,071,008 T193A probably benign Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hecw1 T A 13: 14,264,134 Y1315F probably damaging Het
Hs3st2 A G 7: 121,500,522 D197G possibly damaging Het
Igsf9 T C 1: 172,484,493 I2T probably benign Het
Ints9 A G 14: 65,037,458 E621G probably benign Het
Itm2b G A 14: 73,366,467 P47S probably benign Het
Map10 A G 8: 125,670,399 K177R probably benign Het
Mdh2 T C 5: 135,789,671 F260S possibly damaging Het
Mtmr11 A G 3: 96,170,407 T573A probably benign Het
Mycbp2 A T 14: 103,139,409 I3812N probably damaging Het
Myo15 A G 11: 60,524,475 N3403S probably damaging Het
Nvl G A 1: 181,126,970 Q343* probably null Het
Ocstamp A T 2: 165,397,922 S115T probably benign Het
Olfr632 A T 7: 103,937,586 I69F probably benign Het
Otoa G A 7: 121,092,847 probably null Het
Pcdhb20 A T 18: 37,506,122 N567I probably damaging Het
Pgm5 A T 19: 24,861,647 V48E possibly damaging Het
Phlpp1 T A 1: 106,386,444 S1182R probably damaging Het
Pik3r4 T A 9: 105,650,606 L386Q probably damaging Het
Pop1 A G 15: 34,508,639 K287E possibly damaging Het
Rad54b A G 4: 11,612,777 D803G probably damaging Het
Rbm26 G A 14: 105,116,964 probably benign Het
Rspry1 C T 8: 94,635,431 Q113* probably null Het
Siah2 T A 3: 58,691,770 S16C probably benign Het
Sirpa C A 2: 129,630,097 D481E probably damaging Het
Slc38a7 A C 8: 95,844,920 D227E probably benign Het
Smc5 A G 19: 23,242,787 V438A probably benign Het
Spast A G 17: 74,351,962 E108G probably benign Het
Speg A G 1: 75,417,903 E1752G possibly damaging Het
Tanc2 T G 11: 105,886,490 probably null Het
Tgfbi T C 13: 56,626,137 I243T possibly damaging Het
Tlr12 T C 4: 128,616,892 S522G possibly damaging Het
Trav14-3 A G 14: 53,763,472 I47V probably benign Het
Ttl G A 2: 129,068,915 R73H probably damaging Het
Usp34 C T 11: 23,367,491 T850I possibly damaging Het
Vdac3 T C 8: 22,580,475 Y140C probably damaging Het
Vmn2r120 T C 17: 57,536,659 R62G probably benign Het
Vmn2r17 T A 5: 109,429,465 Y461N probably damaging Het
Wt1 T A 2: 105,172,267 F493I probably damaging Het
Other mutations in Tsc22d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
mastodon UTSW 5 137751370 critical splice donor site probably null
Pachyderm UTSW 5 137751365 missense probably null 0.98
BB001:Tsc22d4 UTSW 5 137768011 missense unknown
BB002:Tsc22d4 UTSW 5 137751365 missense probably null 0.98
BB011:Tsc22d4 UTSW 5 137768011 missense unknown
BB012:Tsc22d4 UTSW 5 137751365 missense probably null 0.98
R0103:Tsc22d4 UTSW 5 137747116 start codon destroyed possibly damaging 0.79
R0570:Tsc22d4 UTSW 5 137762419 missense possibly damaging 0.85
R0600:Tsc22d4 UTSW 5 137762655 missense probably damaging 0.97
R0658:Tsc22d4 UTSW 5 137768021 missense probably benign
R2073:Tsc22d4 UTSW 5 137762487 missense possibly damaging 0.45
R3772:Tsc22d4 UTSW 5 137759233 missense possibly damaging 0.86
R4012:Tsc22d4 UTSW 5 137758328 missense probably benign 0.02
R4232:Tsc22d4 UTSW 5 137751370 critical splice donor site probably null
R5378:Tsc22d4 UTSW 5 137762464 missense probably damaging 0.99
R5394:Tsc22d4 UTSW 5 137758774 intron probably benign
R5677:Tsc22d4 UTSW 5 137747142 missense probably damaging 1.00
R5765:Tsc22d4 UTSW 5 137758543 missense probably benign 0.04
R6184:Tsc22d4 UTSW 5 137759089 missense probably damaging 0.99
R6263:Tsc22d4 UTSW 5 137768179 missense possibly damaging 0.85
R6700:Tsc22d4 UTSW 5 137758523 missense probably benign 0.04
R6877:Tsc22d4 UTSW 5 137762593 missense possibly damaging 0.85
R7354:Tsc22d4 UTSW 5 137768109 missense probably benign 0.12
R7376:Tsc22d4 UTSW 5 137758152 missense unknown
R7499:Tsc22d4 UTSW 5 137747723 missense probably benign 0.19
R7731:Tsc22d4 UTSW 5 137758694 missense possibly damaging 0.93
R7924:Tsc22d4 UTSW 5 137768011 missense unknown
R7925:Tsc22d4 UTSW 5 137751365 missense probably null 0.98
R8556:Tsc22d4 UTSW 5 137747587 missense probably damaging 1.00
Z1186:Tsc22d4 UTSW 5 137758349 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGACACTGTAAAGTTGGTCAAGCC -3'
(R):5'- TTGCAGTTATCCTCAGCTACATGG -3'

Sequencing Primer
(F):5'- GTTGGTCAAGCCCCACAAAGAG -3'
(R):5'- GTTATCCTCAGCTACATGGCAAGC -3'
Posted On2018-10-18