Incidental Mutation 'R6821:C2cd5'
ID537619
Institutional Source Beutler Lab
Gene Symbol C2cd5
Ensembl Gene ENSMUSG00000030279
Gene NameC2 calcium-dependent domain containing 5
Synonyms5730419I09Rik, C030008B15Rik, CDP138
MMRRC Submission
Accession Numbers

Genbank: NM_001109688; NM_029081; NM_029897

Is this an essential gene? Possibly non essential (E-score: 0.432) question?
Stock #R6821 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location143010920-143100141 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143017986 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 891 (V891A)
Ref Sequence ENSEMBL: ENSMUSP00000145373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087485] [ENSMUST00000111758] [ENSMUST00000171349] [ENSMUST00000203187] [ENSMUST00000203673] [ENSMUST00000204655] [ENSMUST00000205119]
Predicted Effect probably damaging
Transcript: ENSMUST00000087485
AA Change: V865A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000084758
Gene: ENSMUSG00000030279
AA Change: V865A

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 309 320 N/A INTRINSIC
low complexity region 350 359 N/A INTRINSIC
internal_repeat_1 381 453 3.98e-5 PROSPERO
low complexity region 637 653 N/A INTRINSIC
internal_repeat_1 909 984 3.98e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000111758
AA Change: V865A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107388
Gene: ENSMUSG00000030279
AA Change: V865A

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.3e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 935 1010 1.3e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000171349
AA Change: V874A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127834
Gene: ENSMUSG00000030279
AA Change: V874A

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.16e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 918 993 1.16e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000203187
AA Change: V891A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145373
Gene: ENSMUSG00000030279
AA Change: V891A

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.3e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 935 1010 1.3e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000203673
AA Change: V927A

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145425
Gene: ENSMUSG00000030279
AA Change: V927A

DomainStartEndE-ValueType
C2 4 105 7.3e-18 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 309 320 N/A INTRINSIC
low complexity region 361 370 N/A INTRINSIC
internal_repeat_1 392 464 4.65e-5 PROSPERO
low complexity region 648 664 N/A INTRINSIC
internal_repeat_1 971 1046 4.65e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000204655
AA Change: V874A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145019
Gene: ENSMUSG00000030279
AA Change: V874A

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.16e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 918 993 1.16e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000205119
SMART Domains Protein: ENSMUSP00000145397
Gene: ENSMUSG00000030279

DomainStartEndE-ValueType
Pfam:C2 3 70 5.4e-14 PFAM
Meta Mutation Damage Score 0.1126 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (63/65)
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,288,836 I417T probably benign Het
Adamts12 A C 15: 11,152,048 K208T probably benign Het
Adamts8 T A 9: 30,956,626 L582Q probably benign Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Ano9 A T 7: 141,107,256 F357I possibly damaging Het
Aox3 T C 1: 58,150,388 V416A probably benign Het
Arhgap21 A C 2: 20,848,848 F1901C probably benign Het
Atp8b2 A T 3: 89,948,173 F506I probably damaging Het
Atp9b A T 18: 80,847,248 L292H probably damaging Het
Ccnt2 T C 1: 127,803,335 S650P probably damaging Het
Cdhr3 T A 12: 33,035,045 N791Y probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
D630003M21Rik A C 2: 158,204,774 L761R probably damaging Het
Draxin G T 4: 148,115,691 Q101K possibly damaging Het
Dtx3l A T 16: 35,933,060 L392Q probably damaging Het
Eif3d A G 15: 77,961,655 S389P possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha4 T C 1: 77,382,945 N757S possibly damaging Het
Fam228b T C 12: 4,763,083 I96V probably benign Het
Gars A G 6: 55,079,338 E728G probably benign Het
Gldn T C 9: 54,338,770 M535T probably benign Het
Gm13089 A T 4: 143,699,304 L23* probably null Het
Gm47985 A G 1: 151,183,036 T143A possibly damaging Het
Gpr6 T C 10: 41,071,008 T193A probably benign Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hecw1 T A 13: 14,264,134 Y1315F probably damaging Het
Hs3st2 A G 7: 121,500,522 D197G possibly damaging Het
Igsf9 T C 1: 172,484,493 I2T probably benign Het
Ints9 A G 14: 65,037,458 E621G probably benign Het
Itm2b G A 14: 73,366,467 P47S probably benign Het
Map10 A G 8: 125,670,399 K177R probably benign Het
Mdh2 T C 5: 135,789,671 F260S possibly damaging Het
Mtmr11 A G 3: 96,170,407 T573A probably benign Het
Mycbp2 A T 14: 103,139,409 I3812N probably damaging Het
Myo15 A G 11: 60,524,475 N3403S probably damaging Het
Nvl G A 1: 181,126,970 Q343* probably null Het
Ocstamp A T 2: 165,397,922 S115T probably benign Het
Olfr632 A T 7: 103,937,586 I69F probably benign Het
Otoa G A 7: 121,092,847 probably null Het
Pcdhb20 A T 18: 37,506,122 N567I probably damaging Het
Pgm5 A T 19: 24,861,647 V48E possibly damaging Het
Phlpp1 T A 1: 106,386,444 S1182R probably damaging Het
Pik3r4 T A 9: 105,650,606 L386Q probably damaging Het
Pop1 A G 15: 34,508,639 K287E possibly damaging Het
Rad54b A G 4: 11,612,777 D803G probably damaging Het
Rbm26 G A 14: 105,116,964 probably benign Het
Rspry1 C T 8: 94,635,431 Q113* probably null Het
Siah2 T A 3: 58,691,770 S16C probably benign Het
Sirpa C A 2: 129,630,097 D481E probably damaging Het
Slc38a7 A C 8: 95,844,920 D227E probably benign Het
Smc5 A G 19: 23,242,787 V438A probably benign Het
Spast A G 17: 74,351,962 E108G probably benign Het
Speg A G 1: 75,417,903 E1752G possibly damaging Het
Tanc2 T G 11: 105,886,490 probably null Het
Tgfbi T C 13: 56,626,137 I243T possibly damaging Het
Tlr12 T C 4: 128,616,892 S522G possibly damaging Het
Trav14-3 A G 14: 53,763,472 I47V probably benign Het
Tsc22d4 T C 5: 137,762,644 V109A possibly damaging Het
Ttl G A 2: 129,068,915 R73H probably damaging Het
Usp34 C T 11: 23,367,491 T850I possibly damaging Het
Vdac3 T C 8: 22,580,475 Y140C probably damaging Het
Vmn2r120 T C 17: 57,536,659 R62G probably benign Het
Vmn2r17 T A 5: 109,429,465 Y461N probably damaging Het
Wt1 T A 2: 105,172,267 F493I probably damaging Het
Other mutations in C2cd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:C2cd5 APN 6 143017945 missense probably null 0.99
IGL01065:C2cd5 APN 6 143078279 missense probably damaging 0.98
IGL01595:C2cd5 APN 6 143018022 missense probably damaging 1.00
IGL01654:C2cd5 APN 6 143081407 missense probably benign 0.06
IGL01917:C2cd5 APN 6 143072596 missense probably benign
IGL01966:C2cd5 APN 6 143012041 nonsense probably null
IGL02417:C2cd5 APN 6 143041492 missense probably damaging 1.00
IGL02616:C2cd5 APN 6 143035111 missense probably benign 0.10
IGL02745:C2cd5 APN 6 143041530 missense probably benign 0.17
IGL02819:C2cd5 APN 6 143083220 missense probably benign 0.33
IGL02926:C2cd5 APN 6 143031237 splice site probably benign
IGL02969:C2cd5 APN 6 143079943 missense probably damaging 1.00
IGL03072:C2cd5 APN 6 143079883 missense possibly damaging 0.89
IGL03226:C2cd5 APN 6 143072566 missense possibly damaging 0.86
D605:C2cd5 UTSW 6 143029660 missense probably benign 0.00
R0385:C2cd5 UTSW 6 143041490 missense probably damaging 1.00
R0497:C2cd5 UTSW 6 143012093 missense probably benign 0.00
R0644:C2cd5 UTSW 6 143013224 missense probably damaging 0.99
R0723:C2cd5 UTSW 6 143041555 splice site probably benign
R0740:C2cd5 UTSW 6 143036263 missense probably damaging 1.00
R1395:C2cd5 UTSW 6 143061738 splice site probably benign
R1475:C2cd5 UTSW 6 143072572 missense possibly damaging 0.47
R1494:C2cd5 UTSW 6 143041346 splice site probably benign
R1645:C2cd5 UTSW 6 143050126 missense probably damaging 1.00
R1928:C2cd5 UTSW 6 143013230 missense probably damaging 1.00
R2253:C2cd5 UTSW 6 143036316 nonsense probably null
R3934:C2cd5 UTSW 6 143041380 missense possibly damaging 0.96
R4065:C2cd5 UTSW 6 143073671 missense probably benign
R4654:C2cd5 UTSW 6 143030184 missense probably benign 0.00
R4691:C2cd5 UTSW 6 143030148 missense possibly damaging 0.47
R4972:C2cd5 UTSW 6 143013224 missense probably damaging 0.99
R5302:C2cd5 UTSW 6 143073756 missense probably benign 0.02
R5362:C2cd5 UTSW 6 143083243 missense probably damaging 1.00
R5604:C2cd5 UTSW 6 143012021 missense probably benign 0.44
R6139:C2cd5 UTSW 6 143035058 missense probably damaging 0.97
R6165:C2cd5 UTSW 6 143050228 missense possibly damaging 0.58
R6567:C2cd5 UTSW 6 143031248 missense possibly damaging 0.86
R6600:C2cd5 UTSW 6 143079976 missense probably damaging 0.99
R6838:C2cd5 UTSW 6 143029638 missense possibly damaging 0.68
R7153:C2cd5 UTSW 6 143019409 missense probably benign 0.04
R7689:C2cd5 UTSW 6 143050225 nonsense probably null
R8027:C2cd5 UTSW 6 143078320 missense possibly damaging 0.95
R8461:C2cd5 UTSW 6 143035076 missense probably damaging 1.00
X0013:C2cd5 UTSW 6 143067082 missense probably damaging 0.99
Z1177:C2cd5 UTSW 6 143029206 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTGCAGTTTCAAATACAGGAG -3'
(R):5'- TAGCCTCACAGACAGCTGAATG -3'

Sequencing Primer
(F):5'- TTGTAAGTTACCTCGCGG -3'
(R):5'- CAGACAGCTGAATGTTATCACCTCTG -3'
Posted On2018-10-18