Incidental Mutation 'R6821:Grik5'
ID537620
Institutional Source Beutler Lab
Gene Symbol Grik5
Ensembl Gene ENSMUSG00000003378
Gene Nameglutamate receptor, ionotropic, kainate 5 (gamma 2)
SynonymsGluRgamma2, KA2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R6821 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location25009849-25072346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25046355 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 431 (R431Q)
Ref Sequence ENSEMBL: ENSMUSP00000003468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003468] [ENSMUST00000205328] [ENSMUST00000206134]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003468
AA Change: R431Q

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003468
Gene: ENSMUSG00000003378
AA Change: R431Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 40 381 3.4e-64 PFAM
PBPe 416 785 3.7e-122 SMART
Lig_chan-Glu_bd 426 490 1.65e-29 SMART
transmembrane domain 804 823 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
low complexity region 893 921 N/A INTRINSIC
low complexity region 962 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205328
Predicted Effect probably benign
Transcript: ENSMUST00000206134
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele display abnormal hippocampal synapse function. Mice homozygous for a second allele display decreased thermal nociception, increased startle response and increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,288,836 I417T probably benign Het
Adamts12 A C 15: 11,152,048 K208T probably benign Het
Adamts8 T A 9: 30,956,626 L582Q probably benign Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Ano9 A T 7: 141,107,256 F357I possibly damaging Het
Aox3 T C 1: 58,150,388 V416A probably benign Het
Arhgap21 A C 2: 20,848,848 F1901C probably benign Het
Atp8b2 A T 3: 89,948,173 F506I probably damaging Het
Atp9b A T 18: 80,847,248 L292H probably damaging Het
C2cd5 A G 6: 143,017,986 V891A probably damaging Het
Ccnt2 T C 1: 127,803,335 S650P probably damaging Het
Cdhr3 T A 12: 33,035,045 N791Y probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
D630003M21Rik A C 2: 158,204,774 L761R probably damaging Het
Draxin G T 4: 148,115,691 Q101K possibly damaging Het
Dtx3l A T 16: 35,933,060 L392Q probably damaging Het
Eif3d A G 15: 77,961,655 S389P possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha4 T C 1: 77,382,945 N757S possibly damaging Het
Fam228b T C 12: 4,763,083 I96V probably benign Het
Gars A G 6: 55,079,338 E728G probably benign Het
Gldn T C 9: 54,338,770 M535T probably benign Het
Gm13089 A T 4: 143,699,304 L23* probably null Het
Gm47985 A G 1: 151,183,036 T143A possibly damaging Het
Gpr6 T C 10: 41,071,008 T193A probably benign Het
Hecw1 T A 13: 14,264,134 Y1315F probably damaging Het
Hs3st2 A G 7: 121,500,522 D197G possibly damaging Het
Igsf9 T C 1: 172,484,493 I2T probably benign Het
Ints9 A G 14: 65,037,458 E621G probably benign Het
Itm2b G A 14: 73,366,467 P47S probably benign Het
Map10 A G 8: 125,670,399 K177R probably benign Het
Mdh2 T C 5: 135,789,671 F260S possibly damaging Het
Mtmr11 A G 3: 96,170,407 T573A probably benign Het
Mycbp2 A T 14: 103,139,409 I3812N probably damaging Het
Myo15 A G 11: 60,524,475 N3403S probably damaging Het
Nvl G A 1: 181,126,970 Q343* probably null Het
Ocstamp A T 2: 165,397,922 S115T probably benign Het
Olfr632 A T 7: 103,937,586 I69F probably benign Het
Otoa G A 7: 121,092,847 probably null Het
Pcdhb20 A T 18: 37,506,122 N567I probably damaging Het
Pgm5 A T 19: 24,861,647 V48E possibly damaging Het
Phlpp1 T A 1: 106,386,444 S1182R probably damaging Het
Pik3r4 T A 9: 105,650,606 L386Q probably damaging Het
Pop1 A G 15: 34,508,639 K287E possibly damaging Het
Rad54b A G 4: 11,612,777 D803G probably damaging Het
Rbm26 G A 14: 105,116,964 probably benign Het
Rspry1 C T 8: 94,635,431 Q113* probably null Het
Siah2 T A 3: 58,691,770 S16C probably benign Het
Sirpa C A 2: 129,630,097 D481E probably damaging Het
Slc38a7 A C 8: 95,844,920 D227E probably benign Het
Smc5 A G 19: 23,242,787 V438A probably benign Het
Spast A G 17: 74,351,962 E108G probably benign Het
Speg A G 1: 75,417,903 E1752G possibly damaging Het
Tanc2 T G 11: 105,886,490 probably null Het
Tgfbi T C 13: 56,626,137 I243T possibly damaging Het
Tlr12 T C 4: 128,616,892 S522G possibly damaging Het
Trav14-3 A G 14: 53,763,472 I47V probably benign Het
Tsc22d4 T C 5: 137,762,644 V109A possibly damaging Het
Ttl G A 2: 129,068,915 R73H probably damaging Het
Usp34 C T 11: 23,367,491 T850I possibly damaging Het
Vdac3 T C 8: 22,580,475 Y140C probably damaging Het
Vmn2r120 T C 17: 57,536,659 R62G probably benign Het
Vmn2r17 T A 5: 109,429,465 Y461N probably damaging Het
Wt1 T A 2: 105,172,267 F493I probably damaging Het
Other mutations in Grik5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Grik5 APN 7 25065393 missense probably damaging 1.00
IGL00974:Grik5 APN 7 25013885 missense probably damaging 1.00
IGL01941:Grik5 APN 7 25065182 missense probably damaging 1.00
IGL02642:Grik5 APN 7 25058983 missense possibly damaging 0.51
IGL03177:Grik5 APN 7 25015454 missense probably damaging 1.00
IGL03402:Grik5 APN 7 25015469 missense probably damaging 1.00
Griffin UTSW 7 25059077 missense possibly damaging 0.78
G1citation:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
PIT4453001:Grik5 UTSW 7 25010694 missense probably damaging 0.99
R0077:Grik5 UTSW 7 25023380 missense probably damaging 1.00
R0412:Grik5 UTSW 7 25013674 missense possibly damaging 0.59
R0427:Grik5 UTSW 7 25058498 missense probably benign 0.34
R1191:Grik5 UTSW 7 25058325 nonsense probably null
R1830:Grik5 UTSW 7 25046301 missense possibly damaging 0.94
R2072:Grik5 UTSW 7 25015313 missense possibly damaging 0.92
R2369:Grik5 UTSW 7 25058537 missense probably damaging 1.00
R3410:Grik5 UTSW 7 25062972 missense probably benign 0.04
R3411:Grik5 UTSW 7 25062972 missense probably benign 0.04
R3615:Grik5 UTSW 7 25022571 missense probably benign 0.37
R3616:Grik5 UTSW 7 25022571 missense probably benign 0.37
R4600:Grik5 UTSW 7 25068064 missense probably damaging 0.99
R4658:Grik5 UTSW 7 25060727 splice site probably benign
R4735:Grik5 UTSW 7 25058288 missense probably damaging 1.00
R4810:Grik5 UTSW 7 25015497 missense probably damaging 0.98
R5113:Grik5 UTSW 7 25015527 missense probably damaging 1.00
R5120:Grik5 UTSW 7 25010640 missense probably damaging 1.00
R5132:Grik5 UTSW 7 25065204 missense probably benign 0.02
R5173:Grik5 UTSW 7 25062894 missense possibly damaging 0.76
R5186:Grik5 UTSW 7 25015819 missense probably damaging 1.00
R5239:Grik5 UTSW 7 25065470 missense probably damaging 1.00
R5935:Grik5 UTSW 7 25059077 missense possibly damaging 0.78
R6335:Grik5 UTSW 7 25013594 missense probably benign
R6609:Grik5 UTSW 7 25015526 nonsense probably null
R6760:Grik5 UTSW 7 25058939 critical splice donor site probably null
R6820:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
R6822:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
R6824:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
R7173:Grik5 UTSW 7 25068162 missense probably damaging 1.00
R7230:Grik5 UTSW 7 25023070 missense probably damaging 1.00
R7555:Grik5 UTSW 7 25060597 missense probably benign
R7560:Grik5 UTSW 7 25058526 missense probably damaging 0.99
R7571:Grik5 UTSW 7 25013885 missense possibly damaging 0.87
R8228:Grik5 UTSW 7 25010508 missense probably damaging 1.00
R8228:Grik5 UTSW 7 25046310 missense possibly damaging 0.93
R8681:Grik5 UTSW 7 25010472 missense probably benign 0.06
X0017:Grik5 UTSW 7 25060588 missense probably damaging 1.00
Z1176:Grik5 UTSW 7 25013804 missense probably damaging 0.98
Z1177:Grik5 UTSW 7 25015825 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTCCAACCATGCCTGT -3'
(R):5'- TCTAAAGGAGTATGTGCACCCG -3'

Sequencing Primer
(F):5'- TGTCCAGGAACCGTTGGG -3'
(R):5'- CTCAGCAGTTCAGAGCATTGG -3'
Posted On2018-10-18