Incidental Mutation 'R6821:Otoa'
ID537622
Institutional Source Beutler Lab
Gene Symbol Otoa
Ensembl Gene ENSMUSG00000034990
Gene Nameotoancorin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6821 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location121081650-121163097 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 121092847 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047025] [ENSMUST00000168311] [ENSMUST00000170106] [ENSMUST00000171880]
Predicted Effect probably null
Transcript: ENSMUST00000047025
SMART Domains Protein: ENSMUSP00000044177
Gene: ENSMUSG00000034990

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1072 1089 N/A INTRINSIC
low complexity region 1124 1133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168311
Predicted Effect probably null
Transcript: ENSMUST00000170106
SMART Domains Protein: ENSMUSP00000133005
Gene: ENSMUSG00000034990

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171880
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is specifically expressed in the inner ear, and is located at the interface between the apical surface of the inner ear sensory epithelia and their overlying acellular gels. It is prposed that this protein is involved in the attachment of the inner ear acellular gels to the apical surface of the underlying nonsensory cells. Mutations in this gene are associated with autosomal recessive deafness type 22 (DFNB22). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss, detachment of the tectorial membrane from the spiral limbus, abnormal tectorial membrane morphology, absence of Hensen's stripe and increased cochlear nerve coumpond action potential threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,288,836 I417T probably benign Het
Adamts12 A C 15: 11,152,048 K208T probably benign Het
Adamts8 T A 9: 30,956,626 L582Q probably benign Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Ano9 A T 7: 141,107,256 F357I possibly damaging Het
Aox3 T C 1: 58,150,388 V416A probably benign Het
Arhgap21 A C 2: 20,848,848 F1901C probably benign Het
Atp8b2 A T 3: 89,948,173 F506I probably damaging Het
Atp9b A T 18: 80,847,248 L292H probably damaging Het
C2cd5 A G 6: 143,017,986 V891A probably damaging Het
Ccnt2 T C 1: 127,803,335 S650P probably damaging Het
Cdhr3 T A 12: 33,035,045 N791Y probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
D630003M21Rik A C 2: 158,204,774 L761R probably damaging Het
Draxin G T 4: 148,115,691 Q101K possibly damaging Het
Dtx3l A T 16: 35,933,060 L392Q probably damaging Het
Eif3d A G 15: 77,961,655 S389P possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha4 T C 1: 77,382,945 N757S possibly damaging Het
Fam228b T C 12: 4,763,083 I96V probably benign Het
Gars A G 6: 55,079,338 E728G probably benign Het
Gldn T C 9: 54,338,770 M535T probably benign Het
Gm13089 A T 4: 143,699,304 L23* probably null Het
Gm47985 A G 1: 151,183,036 T143A possibly damaging Het
Gpr6 T C 10: 41,071,008 T193A probably benign Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hecw1 T A 13: 14,264,134 Y1315F probably damaging Het
Hs3st2 A G 7: 121,500,522 D197G possibly damaging Het
Igsf9 T C 1: 172,484,493 I2T probably benign Het
Ints9 A G 14: 65,037,458 E621G probably benign Het
Itm2b G A 14: 73,366,467 P47S probably benign Het
Map10 A G 8: 125,670,399 K177R probably benign Het
Mdh2 T C 5: 135,789,671 F260S possibly damaging Het
Mtmr11 A G 3: 96,170,407 T573A probably benign Het
Mycbp2 A T 14: 103,139,409 I3812N probably damaging Het
Myo15 A G 11: 60,524,475 N3403S probably damaging Het
Nvl G A 1: 181,126,970 Q343* probably null Het
Ocstamp A T 2: 165,397,922 S115T probably benign Het
Olfr632 A T 7: 103,937,586 I69F probably benign Het
Pcdhb20 A T 18: 37,506,122 N567I probably damaging Het
Pgm5 A T 19: 24,861,647 V48E possibly damaging Het
Phlpp1 T A 1: 106,386,444 S1182R probably damaging Het
Pik3r4 T A 9: 105,650,606 L386Q probably damaging Het
Pop1 A G 15: 34,508,639 K287E possibly damaging Het
Rad54b A G 4: 11,612,777 D803G probably damaging Het
Rbm26 G A 14: 105,116,964 probably benign Het
Rspry1 C T 8: 94,635,431 Q113* probably null Het
Siah2 T A 3: 58,691,770 S16C probably benign Het
Sirpa C A 2: 129,630,097 D481E probably damaging Het
Slc38a7 A C 8: 95,844,920 D227E probably benign Het
Smc5 A G 19: 23,242,787 V438A probably benign Het
Spast A G 17: 74,351,962 E108G probably benign Het
Speg A G 1: 75,417,903 E1752G possibly damaging Het
Tanc2 T G 11: 105,886,490 probably null Het
Tgfbi T C 13: 56,626,137 I243T possibly damaging Het
Tlr12 T C 4: 128,616,892 S522G possibly damaging Het
Trav14-3 A G 14: 53,763,472 I47V probably benign Het
Tsc22d4 T C 5: 137,762,644 V109A possibly damaging Het
Ttl G A 2: 129,068,915 R73H probably damaging Het
Usp34 C T 11: 23,367,491 T850I possibly damaging Het
Vdac3 T C 8: 22,580,475 Y140C probably damaging Het
Vmn2r120 T C 17: 57,536,659 R62G probably benign Het
Vmn2r17 T A 5: 109,429,465 Y461N probably damaging Het
Wt1 T A 2: 105,172,267 F493I probably damaging Het
Other mutations in Otoa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Otoa APN 7 121155273 critical splice donor site probably null
IGL01791:Otoa APN 7 121155849 missense probably benign 0.25
IGL01924:Otoa APN 7 121105968 missense probably damaging 0.99
IGL01953:Otoa APN 7 121160325 splice site probably null
IGL02121:Otoa APN 7 121122024 missense probably benign 0.06
IGL02303:Otoa APN 7 121132924 critical splice donor site probably null
IGL02390:Otoa APN 7 121131367 missense possibly damaging 0.84
IGL02591:Otoa APN 7 121155830 missense probably damaging 1.00
IGL02811:Otoa APN 7 121118655 missense possibly damaging 0.60
IGL02878:Otoa APN 7 121143853 missense probably damaging 1.00
IGL03328:Otoa APN 7 121110994 missense probably damaging 0.98
R0056:Otoa UTSW 7 121131347 missense probably benign 0.00
R0279:Otoa UTSW 7 121111079 splice site probably benign
R0390:Otoa UTSW 7 121131341 missense probably benign 0.07
R0411:Otoa UTSW 7 121156527 critical splice donor site probably null
R0628:Otoa UTSW 7 121145650 splice site probably benign
R1113:Otoa UTSW 7 121125443 nonsense probably null
R1240:Otoa UTSW 7 121156490 missense probably benign
R1308:Otoa UTSW 7 121125443 nonsense probably null
R1692:Otoa UTSW 7 121091551 missense probably damaging 0.99
R1728:Otoa UTSW 7 121125439 missense probably benign 0.36
R1729:Otoa UTSW 7 121125439 missense probably benign 0.36
R1744:Otoa UTSW 7 121127776 splice site probably benign
R1759:Otoa UTSW 7 121134103 missense probably damaging 1.00
R1784:Otoa UTSW 7 121125439 missense probably benign 0.36
R1817:Otoa UTSW 7 121160530 utr 3 prime probably benign
R1961:Otoa UTSW 7 121118569 missense probably benign 0.05
R2061:Otoa UTSW 7 121131328 missense probably damaging 1.00
R2509:Otoa UTSW 7 121160472 missense probably benign
R2510:Otoa UTSW 7 121160472 missense probably benign
R3411:Otoa UTSW 7 121122043 missense probably damaging 1.00
R3438:Otoa UTSW 7 121160343 missense possibly damaging 0.80
R3905:Otoa UTSW 7 121125565 missense probably damaging 1.00
R3907:Otoa UTSW 7 121125565 missense probably damaging 1.00
R4613:Otoa UTSW 7 121145568 missense probably damaging 1.00
R4751:Otoa UTSW 7 121132924 critical splice donor site probably benign
R4896:Otoa UTSW 7 121102679 missense probably damaging 1.00
R4932:Otoa UTSW 7 121155135 missense probably damaging 0.98
R5224:Otoa UTSW 7 121139793 missense probably damaging 0.98
R5235:Otoa UTSW 7 121156470 missense probably damaging 1.00
R5595:Otoa UTSW 7 121121977 missense probably damaging 1.00
R5891:Otoa UTSW 7 121132360 splice site probably null
R5894:Otoa UTSW 7 121121869 missense probably damaging 1.00
R5905:Otoa UTSW 7 121094601 missense probably damaging 1.00
R5976:Otoa UTSW 7 121127713 missense probably benign 0.00
R6464:Otoa UTSW 7 121102605 missense probably damaging 1.00
R6761:Otoa UTSW 7 121121950 missense probably damaging 1.00
R6770:Otoa UTSW 7 121145614 missense probably benign 0.25
R6924:Otoa UTSW 7 121131501 splice site probably null
R7016:Otoa UTSW 7 121147766 missense probably damaging 0.99
R7215:Otoa UTSW 7 121118572 missense unknown
R7313:Otoa UTSW 7 121102542 missense probably benign 0.42
R7340:Otoa UTSW 7 121130065 missense probably benign 0.38
R7443:Otoa UTSW 7 121132410 missense probably benign 0.00
R7559:Otoa UTSW 7 121143926 missense probably damaging 0.99
R7640:Otoa UTSW 7 121145626 missense probably damaging 1.00
R7654:Otoa UTSW 7 121147700 missense probably damaging 1.00
R7659:Otoa UTSW 7 121134044 missense probably benign 0.01
R8421:Otoa UTSW 7 121099268 critical splice donor site probably null
R8799:Otoa UTSW 7 121092671 missense possibly damaging 0.56
U24488:Otoa UTSW 7 121118540 critical splice acceptor site probably null
X0023:Otoa UTSW 7 121118571 missense probably benign 0.00
Z1177:Otoa UTSW 7 121118655 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCAGCGCTGCCAAATTTG -3'
(R):5'- TCTTAAGCTCCGCCATTGGC -3'

Sequencing Primer
(F):5'- GCGCTGCCAAATTTGCATGTTATAC -3'
(R):5'- CGGGATAGTGTTCTAGGAGCAAGTG -3'
Posted On2018-10-18