Mutagenetix > Incidental Mutations

Incidental Mutation 'R6821:Vdac3'

537625

Institutional Source

Beutler Lab

Gene Symbol

Vdac3

Ensembl Gene

ENSMUSG00000008892

Gene Name

voltage-dependent anion channel 3

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.456) question?

Stock #

R6821 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

22577075-22593813 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22580475 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 140 (Y140C)

Ref Sequence

ENSEMBL: ENSMUSP00000136273 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009036] [ENSMUST00000179233]

Predicted Effect

probably damaging
Transcript: ENSMUST00000009036
AA Change: Y139C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000009036
Gene: ENSMUSG00000008892
AA Change: Y139C

Domain	Start	End	E-Value	Type
Pfam:Porin_3	3	276	3.5e-79	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000179233
AA Change: Y140C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000136273
Gene: ENSMUSG00000008892
AA Change: Y140C

Domain	Start	End	E-Value	Type
Pfam:Porin_3	3	277	4.2e-85	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-dependent anion channel (VDAC), and belongs to the mitochondrial porin family. VDACs are small, integral membrane proteins that traverse the outer mitochondrial membrane and conduct ATP and other small metabolites. They are known to bind several kinases of intermediary metabolism, thought to be involved in translocation of adenine nucleotides, and are hypothesized to form part of the mitochondrial permeability transition pore, which results in the release of cytochrome c at the onset of apoptotic cell death. Alternatively transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mutants are male sterile with reduced sperm motility and structural defects in the majority of axonemes in epididymal sperm. Mutants of both genders show deficits in behavioral tests measuring contextual or cued fear conditioning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl5	T	C	19: 55,288,836	I417T	probably benign	Het
Adamts12	A	C	15: 11,152,048	K208T	probably benign	Het
Adamts8	T	A	9: 30,956,626	L582Q	probably benign	Het
Aim2	C	G	1: 173,463,980	T317R	probably damaging	Het
Ano9	A	T	7: 141,107,256	F357I	possibly damaging	Het
Aox3	T	C	1: 58,150,388	V416A	probably benign	Het
Arhgap21	A	C	2: 20,848,848	F1901C	probably benign	Het
Atp8b2	A	T	3: 89,948,173	F506I	probably damaging	Het
Atp9b	A	T	18: 80,847,248	L292H	probably damaging	Het
C2cd5	A	G	6: 143,017,986	V891A	probably damaging	Het
Ccnt2	T	C	1: 127,803,335	S650P	probably damaging	Het
Cdhr3	T	A	12: 33,035,045	N791Y	probably damaging	Het
Cmtm1	TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG	TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG	8: 104,309,702		probably null	Het
D630003M21Rik	A	C	2: 158,204,774	L761R	probably damaging	Het
Draxin	G	T	4: 148,115,691	Q101K	possibly damaging	Het
Dtx3l	A	T	16: 35,933,060	L392Q	probably damaging	Het
Eif3d	A	G	15: 77,961,655	S389P	possibly damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Epha4	T	C	1: 77,382,945	N757S	possibly damaging	Het
Fam228b	T	C	12: 4,763,083	I96V	probably benign	Het
Gars	A	G	6: 55,079,338	E728G	probably benign	Het
Gldn	T	C	9: 54,338,770	M535T	probably benign	Het
Gm13089	A	T	4: 143,699,304	L23*	probably null	Het
Gm47985	A	G	1: 151,183,036	T143A	possibly damaging	Het
Gpr6	T	C	10: 41,071,008	T193A	probably benign	Het
Grik5	C	T	7: 25,046,355	R431Q	possibly damaging	Het
Hecw1	T	A	13: 14,264,134	Y1315F	probably damaging	Het
Hs3st2	A	G	7: 121,500,522	D197G	possibly damaging	Het
Igsf9	T	C	1: 172,484,493	I2T	probably benign	Het
Ints9	A	G	14: 65,037,458	E621G	probably benign	Het
Itm2b	G	A	14: 73,366,467	P47S	probably benign	Het
Map10	A	G	8: 125,670,399	K177R	probably benign	Het
Mdh2	T	C	5: 135,789,671	F260S	possibly damaging	Het
Mtmr11	A	G	3: 96,170,407	T573A	probably benign	Het
Mycbp2	A	T	14: 103,139,409	I3812N	probably damaging	Het
Myo15	A	G	11: 60,524,475	N3403S	probably damaging	Het
Nvl	G	A	1: 181,126,970	Q343*	probably null	Het
Ocstamp	A	T	2: 165,397,922	S115T	probably benign	Het
Olfr632	A	T	7: 103,937,586	I69F	probably benign	Het
Otoa	G	A	7: 121,092,847		probably null	Het
Pcdhb20	A	T	18: 37,506,122	N567I	probably damaging	Het
Pgm5	A	T	19: 24,861,647	V48E	possibly damaging	Het
Phlpp1	T	A	1: 106,386,444	S1182R	probably damaging	Het
Pik3r4	T	A	9: 105,650,606	L386Q	probably damaging	Het
Pop1	A	G	15: 34,508,639	K287E	possibly damaging	Het
Rad54b	A	G	4: 11,612,777	D803G	probably damaging	Het
Rbm26	G	A	14: 105,116,964		probably benign	Het
Rspry1	C	T	8: 94,635,431	Q113*	probably null	Het
Siah2	T	A	3: 58,691,770	S16C	probably benign	Het
Sirpa	C	A	2: 129,630,097	D481E	probably damaging	Het
Slc38a7	A	C	8: 95,844,920	D227E	probably benign	Het
Smc5	A	G	19: 23,242,787	V438A	probably benign	Het
Spast	A	G	17: 74,351,962	E108G	probably benign	Het
Speg	A	G	1: 75,417,903	E1752G	possibly damaging	Het
Tanc2	T	G	11: 105,886,490		probably null	Het
Tgfbi	T	C	13: 56,626,137	I243T	possibly damaging	Het
Tlr12	T	C	4: 128,616,892	S522G	possibly damaging	Het
Trav14-3	A	G	14: 53,763,472	I47V	probably benign	Het
Tsc22d4	T	C	5: 137,762,644	V109A	possibly damaging	Het
Ttl	G	A	2: 129,068,915	R73H	probably damaging	Het
Usp34	C	T	11: 23,367,491	T850I	possibly damaging	Het
Vmn2r120	T	C	17: 57,536,659	R62G	probably benign	Het
Vmn2r17	T	A	5: 109,429,465	Y461N	probably damaging	Het
Wt1	T	A	2: 105,172,267	F493I	probably damaging	Het

Other mutations in Vdac3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00505:Vdac3	APN	8	22580377	missense	possibly damaging	0.89
R0633:Vdac3	UTSW	8	22580388	missense	probably damaging	1.00
R1860:Vdac3	UTSW	8	22580499	missense	possibly damaging	0.87
R1861:Vdac3	UTSW	8	22580499	missense	possibly damaging	0.87
R1865:Vdac3	UTSW	8	22580537	nonsense	probably null
R3777:Vdac3	UTSW	8	22580509	missense	probably benign	0.01
R6221:Vdac3	UTSW	8	22588743	missense	possibly damaging	0.62
R7882:Vdac3	UTSW	8	22579057	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCAGAGGAATTGCACTGGC -3'
(R):5'- CACACACTTGCATCCTAAGAGTTG -3'

Sequencing Primer
(F):5'- CTGGCACTAAAGACGCAATG -3'
(R):5'- CCATATAGTCATCTATCTCTGGGGAG -3'

Posted On

2018-10-18