Incidental Mutation 'R6821:Vdac3'
ID 537625
Institutional Source Beutler Lab
Gene Symbol Vdac3
Ensembl Gene ENSMUSG00000008892
Gene Name voltage-dependent anion channel 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.476) question?
Stock # R6821 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 22577075-22593813 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22580475 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 140 (Y140C)
Ref Sequence ENSEMBL: ENSMUSP00000136273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009036] [ENSMUST00000179233]
AlphaFold Q60931
Predicted Effect probably damaging
Transcript: ENSMUST00000009036
AA Change: Y139C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000009036
Gene: ENSMUSG00000008892
AA Change: Y139C

DomainStartEndE-ValueType
Pfam:Porin_3 3 276 3.5e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179233
AA Change: Y140C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136273
Gene: ENSMUSG00000008892
AA Change: Y140C

DomainStartEndE-ValueType
Pfam:Porin_3 3 277 4.2e-85 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-dependent anion channel (VDAC), and belongs to the mitochondrial porin family. VDACs are small, integral membrane proteins that traverse the outer mitochondrial membrane and conduct ATP and other small metabolites. They are known to bind several kinases of intermediary metabolism, thought to be involved in translocation of adenine nucleotides, and are hypothesized to form part of the mitochondrial permeability transition pore, which results in the release of cytochrome c at the onset of apoptotic cell death. Alternatively transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mutants are male sterile with reduced sperm motility and structural defects in the majority of axonemes in epididymal sperm. Mutants of both genders show deficits in behavioral tests measuring contextual or cued fear conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,288,836 I417T probably benign Het
Adamts12 A C 15: 11,152,048 K208T probably benign Het
Adamts8 T A 9: 30,956,626 L582Q probably benign Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Ano9 A T 7: 141,107,256 F357I possibly damaging Het
Aox3 T C 1: 58,150,388 V416A probably benign Het
Arhgap21 A C 2: 20,848,848 F1901C probably benign Het
Atp8b2 A T 3: 89,948,173 F506I probably damaging Het
Atp9b A T 18: 80,847,248 L292H probably damaging Het
C2cd5 A G 6: 143,017,986 V891A probably damaging Het
Ccnt2 T C 1: 127,803,335 S650P probably damaging Het
Cdhr3 T A 12: 33,035,045 N791Y probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
D630003M21Rik A C 2: 158,204,774 L761R probably damaging Het
Draxin G T 4: 148,115,691 Q101K possibly damaging Het
Dtx3l A T 16: 35,933,060 L392Q probably damaging Het
Eif3d A G 15: 77,961,655 S389P possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha4 T C 1: 77,382,945 N757S possibly damaging Het
Fam228b T C 12: 4,763,083 I96V probably benign Het
Gars A G 6: 55,079,338 E728G probably benign Het
Gldn T C 9: 54,338,770 M535T probably benign Het
Gm13089 A T 4: 143,699,304 L23* probably null Het
Gm47985 A G 1: 151,183,036 T143A possibly damaging Het
Gpr6 T C 10: 41,071,008 T193A probably benign Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hecw1 T A 13: 14,264,134 Y1315F probably damaging Het
Hs3st2 A G 7: 121,500,522 D197G possibly damaging Het
Igsf9 T C 1: 172,484,493 I2T probably benign Het
Ints9 A G 14: 65,037,458 E621G probably benign Het
Itm2b G A 14: 73,366,467 P47S probably benign Het
Map10 A G 8: 125,670,399 K177R probably benign Het
Mdh2 T C 5: 135,789,671 F260S possibly damaging Het
Mtmr11 A G 3: 96,170,407 T573A probably benign Het
Mycbp2 A T 14: 103,139,409 I3812N probably damaging Het
Myo15 A G 11: 60,524,475 N3403S probably damaging Het
Nvl G A 1: 181,126,970 Q343* probably null Het
Ocstamp A T 2: 165,397,922 S115T probably benign Het
Olfr632 A T 7: 103,937,586 I69F probably benign Het
Otoa G A 7: 121,092,847 probably null Het
Pcdhb20 A T 18: 37,506,122 N567I probably damaging Het
Pgm5 A T 19: 24,861,647 V48E possibly damaging Het
Phlpp1 T A 1: 106,386,444 S1182R probably damaging Het
Pik3r4 T A 9: 105,650,606 L386Q probably damaging Het
Pop1 A G 15: 34,508,639 K287E possibly damaging Het
Rad54b A G 4: 11,612,777 D803G probably damaging Het
Rbm26 G A 14: 105,116,964 probably benign Het
Rspry1 C T 8: 94,635,431 Q113* probably null Het
Siah2 T A 3: 58,691,770 S16C probably benign Het
Sirpa C A 2: 129,630,097 D481E probably damaging Het
Slc38a7 A C 8: 95,844,920 D227E probably benign Het
Smc5 A G 19: 23,242,787 V438A probably benign Het
Spast A G 17: 74,351,962 E108G probably benign Het
Speg A G 1: 75,417,903 E1752G possibly damaging Het
Tanc2 T G 11: 105,886,490 probably null Het
Tgfbi T C 13: 56,626,137 I243T possibly damaging Het
Tlr12 T C 4: 128,616,892 S522G possibly damaging Het
Trav14-3 A G 14: 53,763,472 I47V probably benign Het
Tsc22d4 T C 5: 137,762,644 V109A possibly damaging Het
Ttl G A 2: 129,068,915 R73H probably damaging Het
Usp34 C T 11: 23,367,491 T850I possibly damaging Het
Vmn2r120 T C 17: 57,536,659 R62G probably benign Het
Vmn2r17 T A 5: 109,429,465 Y461N probably damaging Het
Wt1 T A 2: 105,172,267 F493I probably damaging Het
Other mutations in Vdac3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Vdac3 APN 8 22580377 missense possibly damaging 0.89
R0633:Vdac3 UTSW 8 22580388 missense probably damaging 1.00
R1860:Vdac3 UTSW 8 22580499 missense possibly damaging 0.87
R1861:Vdac3 UTSW 8 22580499 missense possibly damaging 0.87
R1865:Vdac3 UTSW 8 22580537 nonsense probably null
R3777:Vdac3 UTSW 8 22580509 missense probably benign 0.01
R6221:Vdac3 UTSW 8 22588743 missense possibly damaging 0.62
R7882:Vdac3 UTSW 8 22579057 missense probably damaging 1.00
R9304:Vdac3 UTSW 8 22580552 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCAGAGGAATTGCACTGGC -3'
(R):5'- CACACACTTGCATCCTAAGAGTTG -3'

Sequencing Primer
(F):5'- CTGGCACTAAAGACGCAATG -3'
(R):5'- CCATATAGTCATCTATCTCTGGGGAG -3'
Posted On 2018-10-18