Mutagenetix > Incidental Mutations

Incidental Mutation 'R6821:Tgfbi'

537639

Institutional Source

Beutler Lab

Gene Symbol

Tgfbi

Ensembl Gene

ENSMUSG00000035493

Gene Name

transforming growth factor, beta induced

Synonyms

68kDa, bIG-h3, Beta-ig

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.206) question?

Stock #

R6821 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

56609523-56639562 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 56626137 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 243 (I243T)

Ref Sequence

ENSEMBL: ENSMUSP00000153546 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045173] [ENSMUST00000225600]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045173
AA Change: I243T

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000037719
Gene: ENSMUSG00000035493
AA Change: I243T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FAS1	139	239	1.35e-33	SMART
FAS1	276	374	6.75e-34	SMART
FAS1	411	501	1.16e-14	SMART
FAS1	538	635	6.75e-34	SMART
low complexity region	656	667	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225600
AA Change: I243T

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. This protein plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. The protein is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in this gene are associated with multiple types of corneal dystrophy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show delayed growth and are prone to spontaneous and induced tumors. Homozygotes for a second null allele are prone to STZ-induced diabetes and show impaired islet function under stress. Homozygotes for a third null allele show a transient decrease in retinal apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl5	T	C	19: 55,288,836	I417T	probably benign	Het
Adamts12	A	C	15: 11,152,048	K208T	probably benign	Het
Adamts8	T	A	9: 30,956,626	L582Q	probably benign	Het
Aim2	C	G	1: 173,463,980	T317R	probably damaging	Het
Ano9	A	T	7: 141,107,256	F357I	possibly damaging	Het
Aox3	T	C	1: 58,150,388	V416A	probably benign	Het
Arhgap21	A	C	2: 20,848,848	F1901C	probably benign	Het
Atp8b2	A	T	3: 89,948,173	F506I	probably damaging	Het
Atp9b	A	T	18: 80,847,248	L292H	probably damaging	Het
C2cd5	A	G	6: 143,017,986	V891A	probably damaging	Het
Ccnt2	T	C	1: 127,803,335	S650P	probably damaging	Het
Cdhr3	T	A	12: 33,035,045	N791Y	probably damaging	Het
Cmtm1	TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG	TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG	8: 104,309,702		probably null	Het
D630003M21Rik	A	C	2: 158,204,774	L761R	probably damaging	Het
Draxin	G	T	4: 148,115,691	Q101K	possibly damaging	Het
Dtx3l	A	T	16: 35,933,060	L392Q	probably damaging	Het
Eif3d	A	G	15: 77,961,655	S389P	possibly damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Epha4	T	C	1: 77,382,945	N757S	possibly damaging	Het
Fam228b	T	C	12: 4,763,083	I96V	probably benign	Het
Gars	A	G	6: 55,079,338	E728G	probably benign	Het
Gldn	T	C	9: 54,338,770	M535T	probably benign	Het
Gm13089	A	T	4: 143,699,304	L23*	probably null	Het
Gm47985	A	G	1: 151,183,036	T143A	possibly damaging	Het
Gpr6	T	C	10: 41,071,008	T193A	probably benign	Het
Grik5	C	T	7: 25,046,355	R431Q	possibly damaging	Het
Hecw1	T	A	13: 14,264,134	Y1315F	probably damaging	Het
Hs3st2	A	G	7: 121,500,522	D197G	possibly damaging	Het
Igsf9	T	C	1: 172,484,493	I2T	probably benign	Het
Ints9	A	G	14: 65,037,458	E621G	probably benign	Het
Itm2b	G	A	14: 73,366,467	P47S	probably benign	Het
Map10	A	G	8: 125,670,399	K177R	probably benign	Het
Mdh2	T	C	5: 135,789,671	F260S	possibly damaging	Het
Mtmr11	A	G	3: 96,170,407	T573A	probably benign	Het
Mycbp2	A	T	14: 103,139,409	I3812N	probably damaging	Het
Myo15	A	G	11: 60,524,475	N3403S	probably damaging	Het
Nvl	G	A	1: 181,126,970	Q343*	probably null	Het
Ocstamp	A	T	2: 165,397,922	S115T	probably benign	Het
Olfr632	A	T	7: 103,937,586	I69F	probably benign	Het
Otoa	G	A	7: 121,092,847		probably null	Het
Pcdhb20	A	T	18: 37,506,122	N567I	probably damaging	Het
Pgm5	A	T	19: 24,861,647	V48E	possibly damaging	Het
Phlpp1	T	A	1: 106,386,444	S1182R	probably damaging	Het
Pik3r4	T	A	9: 105,650,606	L386Q	probably damaging	Het
Pop1	A	G	15: 34,508,639	K287E	possibly damaging	Het
Rad54b	A	G	4: 11,612,777	D803G	probably damaging	Het
Rbm26	G	A	14: 105,116,964		probably benign	Het
Rspry1	C	T	8: 94,635,431	Q113*	probably null	Het
Siah2	T	A	3: 58,691,770	S16C	probably benign	Het
Sirpa	C	A	2: 129,630,097	D481E	probably damaging	Het
Slc38a7	A	C	8: 95,844,920	D227E	probably benign	Het
Smc5	A	G	19: 23,242,787	V438A	probably benign	Het
Spast	A	G	17: 74,351,962	E108G	probably benign	Het
Speg	A	G	1: 75,417,903	E1752G	possibly damaging	Het
Tanc2	T	G	11: 105,886,490		probably null	Het
Tlr12	T	C	4: 128,616,892	S522G	possibly damaging	Het
Trav14-3	A	G	14: 53,763,472	I47V	probably benign	Het
Tsc22d4	T	C	5: 137,762,644	V109A	possibly damaging	Het
Ttl	G	A	2: 129,068,915	R73H	probably damaging	Het
Usp34	C	T	11: 23,367,491	T850I	possibly damaging	Het
Vdac3	T	C	8: 22,580,475	Y140C	probably damaging	Het
Vmn2r120	T	C	17: 57,536,659	R62G	probably benign	Het
Vmn2r17	T	A	5: 109,429,465	Y461N	probably damaging	Het
Wt1	T	A	2: 105,172,267	F493I	probably damaging	Het

Other mutations in Tgfbi

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Tgfbi	APN	13	56630595	missense	probably benign	0.41
IGL02021:Tgfbi	APN	13	56631353	missense	probably damaging	1.00
IGL02325:Tgfbi	APN	13	56631230	missense	probably benign	0.00
PIT4486001:Tgfbi	UTSW	13	56629794	missense	probably damaging	0.98
R0008:Tgfbi	UTSW	13	56629774	missense	probably benign	0.00
R0122:Tgfbi	UTSW	13	56627968	missense	probably damaging	1.00
R0389:Tgfbi	UTSW	13	56629702	missense	probably benign	0.02
R0419:Tgfbi	UTSW	13	56632193	splice site	probably benign
R0432:Tgfbi	UTSW	13	56632191	splice site	probably benign
R0671:Tgfbi	UTSW	13	56638726	missense	probably null	1.00
R0825:Tgfbi	UTSW	13	56638710	splice site	probably benign
R1263:Tgfbi	UTSW	13	56630655	missense	probably damaging	1.00
R1597:Tgfbi	UTSW	13	56632191	splice site	probably benign
R1864:Tgfbi	UTSW	13	56632881	missense	probably benign	0.16
R1940:Tgfbi	UTSW	13	56614314	missense	possibly damaging	0.92
R2570:Tgfbi	UTSW	13	56638708	splice site	probably null
R3111:Tgfbi	UTSW	13	56609734	missense	probably damaging	1.00
R3613:Tgfbi	UTSW	13	56625726	missense	probably damaging	1.00
R4815:Tgfbi	UTSW	13	56632120	missense	probably benign	0.45
R5847:Tgfbi	UTSW	13	56636605	missense	possibly damaging	0.94
R6314:Tgfbi	UTSW	13	56626163	missense	probably benign	0.01
R6810:Tgfbi	UTSW	13	56637203	missense	probably benign
R6943:Tgfbi	UTSW	13	56637176	missense	possibly damaging	0.77
R7165:Tgfbi	UTSW	13	56628016	missense	probably damaging	0.99
R7297:Tgfbi	UTSW	13	56632113	missense	possibly damaging	0.74
R7910:Tgfbi	UTSW	13	56632184	missense	probably damaging	1.00
R7991:Tgfbi	UTSW	13	56632184	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACATCCTGCCCTTAGCTG -3'
(R):5'- ATATCGGGCATTTCTCACGCTC -3'

Sequencing Primer
(F):5'- AGCTGTGTACCCGCTGTTC -3'
(R):5'- ACGCTCTGTCCAGCCTG -3'

Posted On

2018-10-18