Incidental Mutation 'R6821:Itm2b'
ID537642
Institutional Source Beutler Lab
Gene Symbol Itm2b
Ensembl Gene ENSMUSG00000022108
Gene Nameintegral membrane protein 2B
SynonymsBri2, D14Sel6, Bricd2b
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R6821 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location73362226-73385289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73366467 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 47 (P47S)
Ref Sequence ENSEMBL: ENSMUSP00000153948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022704] [ENSMUST00000227454]
Predicted Effect probably benign
Transcript: ENSMUST00000022704
AA Change: P103S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022704
Gene: ENSMUSG00000022108
AA Change: P103S

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
BRICHOS 137 231 3.32e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227454
AA Change: P47S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Amyloid precursor proteins are processed by beta-secretase and gamma-secretase to produce beta-amyloid peptides which form the characteristic plaques of Alzheimer disease. This gene encodes a transmembrane protein which is processed at the C-terminus by furin or furin-like proteases to produce a small secreted peptide which inhibits the deposition of beta-amyloid. Mutations which result in extension of the C-terminal end of the encoded protein, thereby increasing the size of the secreted peptide, are associated with two neurogenerative diseases, familial British dementia and familial Danish dementia. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation display increased levels of soluble APP fragments in the brain. Mice homozygous for a knock-in allele exhibit impaired oject recognition, impaired contextual conditioning, and impaired spatial working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,288,836 I417T probably benign Het
Adamts12 A C 15: 11,152,048 K208T probably benign Het
Adamts8 T A 9: 30,956,626 L582Q probably benign Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Ano9 A T 7: 141,107,256 F357I possibly damaging Het
Aox3 T C 1: 58,150,388 V416A probably benign Het
Arhgap21 A C 2: 20,848,848 F1901C probably benign Het
Atp8b2 A T 3: 89,948,173 F506I probably damaging Het
Atp9b A T 18: 80,847,248 L292H probably damaging Het
C2cd5 A G 6: 143,017,986 V891A probably damaging Het
Ccnt2 T C 1: 127,803,335 S650P probably damaging Het
Cdhr3 T A 12: 33,035,045 N791Y probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
D630003M21Rik A C 2: 158,204,774 L761R probably damaging Het
Draxin G T 4: 148,115,691 Q101K possibly damaging Het
Dtx3l A T 16: 35,933,060 L392Q probably damaging Het
Eif3d A G 15: 77,961,655 S389P possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha4 T C 1: 77,382,945 N757S possibly damaging Het
Fam228b T C 12: 4,763,083 I96V probably benign Het
Gars A G 6: 55,079,338 E728G probably benign Het
Gldn T C 9: 54,338,770 M535T probably benign Het
Gm13089 A T 4: 143,699,304 L23* probably null Het
Gm47985 A G 1: 151,183,036 T143A possibly damaging Het
Gpr6 T C 10: 41,071,008 T193A probably benign Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hecw1 T A 13: 14,264,134 Y1315F probably damaging Het
Hs3st2 A G 7: 121,500,522 D197G possibly damaging Het
Igsf9 T C 1: 172,484,493 I2T probably benign Het
Ints9 A G 14: 65,037,458 E621G probably benign Het
Map10 A G 8: 125,670,399 K177R probably benign Het
Mdh2 T C 5: 135,789,671 F260S possibly damaging Het
Mtmr11 A G 3: 96,170,407 T573A probably benign Het
Mycbp2 A T 14: 103,139,409 I3812N probably damaging Het
Myo15 A G 11: 60,524,475 N3403S probably damaging Het
Nvl G A 1: 181,126,970 Q343* probably null Het
Ocstamp A T 2: 165,397,922 S115T probably benign Het
Olfr632 A T 7: 103,937,586 I69F probably benign Het
Otoa G A 7: 121,092,847 probably null Het
Pcdhb20 A T 18: 37,506,122 N567I probably damaging Het
Pgm5 A T 19: 24,861,647 V48E possibly damaging Het
Phlpp1 T A 1: 106,386,444 S1182R probably damaging Het
Pik3r4 T A 9: 105,650,606 L386Q probably damaging Het
Pop1 A G 15: 34,508,639 K287E possibly damaging Het
Rad54b A G 4: 11,612,777 D803G probably damaging Het
Rbm26 G A 14: 105,116,964 probably benign Het
Rspry1 C T 8: 94,635,431 Q113* probably null Het
Siah2 T A 3: 58,691,770 S16C probably benign Het
Sirpa C A 2: 129,630,097 D481E probably damaging Het
Slc38a7 A C 8: 95,844,920 D227E probably benign Het
Smc5 A G 19: 23,242,787 V438A probably benign Het
Spast A G 17: 74,351,962 E108G probably benign Het
Speg A G 1: 75,417,903 E1752G possibly damaging Het
Tanc2 T G 11: 105,886,490 probably null Het
Tgfbi T C 13: 56,626,137 I243T possibly damaging Het
Tlr12 T C 4: 128,616,892 S522G possibly damaging Het
Trav14-3 A G 14: 53,763,472 I47V probably benign Het
Tsc22d4 T C 5: 137,762,644 V109A possibly damaging Het
Ttl G A 2: 129,068,915 R73H probably damaging Het
Usp34 C T 11: 23,367,491 T850I possibly damaging Het
Vdac3 T C 8: 22,580,475 Y140C probably damaging Het
Vmn2r120 T C 17: 57,536,659 R62G probably benign Het
Vmn2r17 T A 5: 109,429,465 Y461N probably damaging Het
Wt1 T A 2: 105,172,267 F493I probably damaging Het
Other mutations in Itm2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Itm2b APN 14 73364616 missense probably benign
IGL00864:Itm2b APN 14 73363135 missense probably damaging 1.00
IGL02006:Itm2b APN 14 73363048 unclassified probably benign
IGL02383:Itm2b APN 14 73363096 nonsense probably null
IGL03190:Itm2b APN 14 73365789 missense probably damaging 1.00
IGL03202:Itm2b APN 14 73365789 missense probably damaging 1.00
R0194:Itm2b UTSW 14 73364618 missense probably benign 0.22
R0699:Itm2b UTSW 14 73364625 missense probably damaging 1.00
R2068:Itm2b UTSW 14 73363135 missense probably damaging 1.00
R2077:Itm2b UTSW 14 73363120 missense probably benign
R7151:Itm2b UTSW 14 73368389 start gained probably benign
R7290:Itm2b UTSW 14 73368345 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTACTAGAGACCCTGAGCTC -3'
(R):5'- AAACTGTCTGACTTGTCATCTGG -3'

Sequencing Primer
(F):5'- ACTAGAGACCCTGAGCTCTTTTC -3'
(R):5'- GTCTGACTTGTCATCTGGAAAGTAAG -3'
Posted On2018-10-18