Incidental Mutation 'R6821:Spast'
ID537650
Institutional Source Beutler Lab
Gene Symbol Spast
Ensembl Gene ENSMUSG00000024068
Gene Namespastin
SynonymsSpg4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6821 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location74338987-74391115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74351962 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 108 (E108G)
Ref Sequence ENSEMBL: ENSMUSP00000153004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024869] [ENSMUST00000224711] [ENSMUST00000225549]
Predicted Effect probably benign
Transcript: ENSMUST00000024869
AA Change: E141G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000024869
Gene: ENSMUSG00000024068
AA Change: E141G

DomainStartEndE-ValueType
low complexity region 3 46 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
low complexity region 90 113 N/A INTRINSIC
MIT 114 192 4.33e-18 SMART
AAA 372 508 7.59e-17 SMART
low complexity region 513 520 N/A INTRINSIC
Pfam:Vps4_C 560 610 1.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224711
AA Change: E140G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000225549
AA Change: E108G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with a variety of cellular activities) protein family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. The encoded ATPase may be involved in the assembly or function of nuclear protein complexes. Two transcript variants encoding distinct isoforms have been identified for this gene. Other alternative splice variants have been described but their full length sequences have not been determined. Mutations associated with this gene cause the most frequent form of autosomal dominant spastic paraplegia 4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene are sterile and display progressive axonopathy with focal axonal swellings and late onset gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,288,836 I417T probably benign Het
Adamts12 A C 15: 11,152,048 K208T probably benign Het
Adamts8 T A 9: 30,956,626 L582Q probably benign Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Ano9 A T 7: 141,107,256 F357I possibly damaging Het
Aox3 T C 1: 58,150,388 V416A probably benign Het
Arhgap21 A C 2: 20,848,848 F1901C probably benign Het
Atp8b2 A T 3: 89,948,173 F506I probably damaging Het
Atp9b A T 18: 80,847,248 L292H probably damaging Het
C2cd5 A G 6: 143,017,986 V891A probably damaging Het
Ccnt2 T C 1: 127,803,335 S650P probably damaging Het
Cdhr3 T A 12: 33,035,045 N791Y probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
D630003M21Rik A C 2: 158,204,774 L761R probably damaging Het
Draxin G T 4: 148,115,691 Q101K possibly damaging Het
Dtx3l A T 16: 35,933,060 L392Q probably damaging Het
Eif3d A G 15: 77,961,655 S389P possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha4 T C 1: 77,382,945 N757S possibly damaging Het
Fam228b T C 12: 4,763,083 I96V probably benign Het
Gars A G 6: 55,079,338 E728G probably benign Het
Gldn T C 9: 54,338,770 M535T probably benign Het
Gm13089 A T 4: 143,699,304 L23* probably null Het
Gm47985 A G 1: 151,183,036 T143A possibly damaging Het
Gpr6 T C 10: 41,071,008 T193A probably benign Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hecw1 T A 13: 14,264,134 Y1315F probably damaging Het
Hs3st2 A G 7: 121,500,522 D197G possibly damaging Het
Igsf9 T C 1: 172,484,493 I2T probably benign Het
Ints9 A G 14: 65,037,458 E621G probably benign Het
Itm2b G A 14: 73,366,467 P47S probably benign Het
Map10 A G 8: 125,670,399 K177R probably benign Het
Mdh2 T C 5: 135,789,671 F260S possibly damaging Het
Mtmr11 A G 3: 96,170,407 T573A probably benign Het
Mycbp2 A T 14: 103,139,409 I3812N probably damaging Het
Myo15 A G 11: 60,524,475 N3403S probably damaging Het
Nvl G A 1: 181,126,970 Q343* probably null Het
Ocstamp A T 2: 165,397,922 S115T probably benign Het
Olfr632 A T 7: 103,937,586 I69F probably benign Het
Otoa G A 7: 121,092,847 probably null Het
Pcdhb20 A T 18: 37,506,122 N567I probably damaging Het
Pgm5 A T 19: 24,861,647 V48E possibly damaging Het
Phlpp1 T A 1: 106,386,444 S1182R probably damaging Het
Pik3r4 T A 9: 105,650,606 L386Q probably damaging Het
Pop1 A G 15: 34,508,639 K287E possibly damaging Het
Rad54b A G 4: 11,612,777 D803G probably damaging Het
Rbm26 G A 14: 105,116,964 probably benign Het
Rspry1 C T 8: 94,635,431 Q113* probably null Het
Siah2 T A 3: 58,691,770 S16C probably benign Het
Sirpa C A 2: 129,630,097 D481E probably damaging Het
Slc38a7 A C 8: 95,844,920 D227E probably benign Het
Smc5 A G 19: 23,242,787 V438A probably benign Het
Speg A G 1: 75,417,903 E1752G possibly damaging Het
Tanc2 T G 11: 105,886,490 probably null Het
Tgfbi T C 13: 56,626,137 I243T possibly damaging Het
Tlr12 T C 4: 128,616,892 S522G possibly damaging Het
Trav14-3 A G 14: 53,763,472 I47V probably benign Het
Tsc22d4 T C 5: 137,762,644 V109A possibly damaging Het
Ttl G A 2: 129,068,915 R73H probably damaging Het
Usp34 C T 11: 23,367,491 T850I possibly damaging Het
Vdac3 T C 8: 22,580,475 Y140C probably damaging Het
Vmn2r120 T C 17: 57,536,659 R62G probably benign Het
Vmn2r17 T A 5: 109,429,465 Y461N probably damaging Het
Wt1 T A 2: 105,172,267 F493I probably damaging Het
Other mutations in Spast
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Spast APN 17 74372339 splice site probably benign
R0671:Spast UTSW 17 74339451 splice site probably benign
R1170:Spast UTSW 17 74381968 critical splice acceptor site probably null
R1698:Spast UTSW 17 74356160 nonsense probably null
R2076:Spast UTSW 17 74352031 missense probably damaging 1.00
R4334:Spast UTSW 17 74352015 missense probably damaging 1.00
R4765:Spast UTSW 17 74369216 missense probably damaging 1.00
R5002:Spast UTSW 17 74369226 nonsense probably null
R5911:Spast UTSW 17 74387063 missense probably benign 0.00
R6073:Spast UTSW 17 74373305 missense probably damaging 1.00
R6183:Spast UTSW 17 74373358 missense probably damaging 0.99
R6450:Spast UTSW 17 74368840 missense probably benign 0.01
R6819:Spast UTSW 17 74367286 missense possibly damaging 0.47
R7349:Spast UTSW 17 74373324 missense probably damaging 0.99
R7611:Spast UTSW 17 74369203 missense probably damaging 1.00
R7715:Spast UTSW 17 74368926 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGAAACACTGGGACTATAGTC -3'
(R):5'- AGGGCATGGCAGTACATTTGG -3'

Sequencing Primer
(F):5'- GGGACTATAGTCTCCCTCTTGG -3'
(R):5'- AGTACATTTGGTTTACTCCACCAGG -3'
Posted On2018-10-18