Mutagenetix > Incidental Mutations

Incidental Mutation 'R6821:Spast'

537650

Institutional Source

Beutler Lab

Gene Symbol

Spast

Ensembl Gene

ENSMUSG00000024068

Gene Name

spastin

Synonyms

Spg4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6821 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74338987-74391115 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74351962 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 108 (E108G)

Ref Sequence

ENSEMBL: ENSMUSP00000153004 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024869] [ENSMUST00000224711] [ENSMUST00000225549]

Predicted Effect

probably benign
Transcript: ENSMUST00000024869
AA Change: E141G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000024869
Gene: ENSMUSG00000024068
AA Change: E141G

Domain	Start	End	E-Value	Type
low complexity region	3	46	N/A	INTRINSIC
transmembrane domain	55	77	N/A	INTRINSIC
low complexity region	90	113	N/A	INTRINSIC
MIT	114	192	4.33e-18	SMART
AAA	372	508	7.59e-17	SMART
low complexity region	513	520	N/A	INTRINSIC
Pfam:Vps4_C	560	610	1.3e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000224711
AA Change: E140G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

Predicted Effect

probably benign
Transcript: ENSMUST00000225549
AA Change: E108G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with a variety of cellular activities) protein family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. The encoded ATPase may be involved in the assembly or function of nuclear protein complexes. Two transcript variants encoding distinct isoforms have been identified for this gene. Other alternative splice variants have been described but their full length sequences have not been determined. Mutations associated with this gene cause the most frequent form of autosomal dominant spastic paraplegia 4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene are sterile and display progressive axonopathy with focal axonal swellings and late onset gait abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl5	T	C	19: 55,288,836	I417T	probably benign	Het
Adamts12	A	C	15: 11,152,048	K208T	probably benign	Het
Adamts8	T	A	9: 30,956,626	L582Q	probably benign	Het
Aim2	C	G	1: 173,463,980	T317R	probably damaging	Het
Ano9	A	T	7: 141,107,256	F357I	possibly damaging	Het
Aox3	T	C	1: 58,150,388	V416A	probably benign	Het
Arhgap21	A	C	2: 20,848,848	F1901C	probably benign	Het
Atp8b2	A	T	3: 89,948,173	F506I	probably damaging	Het
Atp9b	A	T	18: 80,847,248	L292H	probably damaging	Het
C2cd5	A	G	6: 143,017,986	V891A	probably damaging	Het
Ccnt2	T	C	1: 127,803,335	S650P	probably damaging	Het
Cdhr3	T	A	12: 33,035,045	N791Y	probably damaging	Het
Cmtm1	TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG	TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG	8: 104,309,702		probably null	Het
D630003M21Rik	A	C	2: 158,204,774	L761R	probably damaging	Het
Draxin	G	T	4: 148,115,691	Q101K	possibly damaging	Het
Dtx3l	A	T	16: 35,933,060	L392Q	probably damaging	Het
Eif3d	A	G	15: 77,961,655	S389P	possibly damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Epha4	T	C	1: 77,382,945	N757S	possibly damaging	Het
Fam228b	T	C	12: 4,763,083	I96V	probably benign	Het
Gars	A	G	6: 55,079,338	E728G	probably benign	Het
Gldn	T	C	9: 54,338,770	M535T	probably benign	Het
Gm13089	A	T	4: 143,699,304	L23*	probably null	Het
Gm47985	A	G	1: 151,183,036	T143A	possibly damaging	Het
Gpr6	T	C	10: 41,071,008	T193A	probably benign	Het
Grik5	C	T	7: 25,046,355	R431Q	possibly damaging	Het
Hecw1	T	A	13: 14,264,134	Y1315F	probably damaging	Het
Hs3st2	A	G	7: 121,500,522	D197G	possibly damaging	Het
Igsf9	T	C	1: 172,484,493	I2T	probably benign	Het
Ints9	A	G	14: 65,037,458	E621G	probably benign	Het
Itm2b	G	A	14: 73,366,467	P47S	probably benign	Het
Map10	A	G	8: 125,670,399	K177R	probably benign	Het
Mdh2	T	C	5: 135,789,671	F260S	possibly damaging	Het
Mtmr11	A	G	3: 96,170,407	T573A	probably benign	Het
Mycbp2	A	T	14: 103,139,409	I3812N	probably damaging	Het
Myo15	A	G	11: 60,524,475	N3403S	probably damaging	Het
Nvl	G	A	1: 181,126,970	Q343*	probably null	Het
Ocstamp	A	T	2: 165,397,922	S115T	probably benign	Het
Olfr632	A	T	7: 103,937,586	I69F	probably benign	Het
Otoa	G	A	7: 121,092,847		probably null	Het
Pcdhb20	A	T	18: 37,506,122	N567I	probably damaging	Het
Pgm5	A	T	19: 24,861,647	V48E	possibly damaging	Het
Phlpp1	T	A	1: 106,386,444	S1182R	probably damaging	Het
Pik3r4	T	A	9: 105,650,606	L386Q	probably damaging	Het
Pop1	A	G	15: 34,508,639	K287E	possibly damaging	Het
Rad54b	A	G	4: 11,612,777	D803G	probably damaging	Het
Rbm26	G	A	14: 105,116,964		probably benign	Het
Rspry1	C	T	8: 94,635,431	Q113*	probably null	Het
Siah2	T	A	3: 58,691,770	S16C	probably benign	Het
Sirpa	C	A	2: 129,630,097	D481E	probably damaging	Het
Slc38a7	A	C	8: 95,844,920	D227E	probably benign	Het
Smc5	A	G	19: 23,242,787	V438A	probably benign	Het
Speg	A	G	1: 75,417,903	E1752G	possibly damaging	Het
Tanc2	T	G	11: 105,886,490		probably null	Het
Tgfbi	T	C	13: 56,626,137	I243T	possibly damaging	Het
Tlr12	T	C	4: 128,616,892	S522G	possibly damaging	Het
Trav14-3	A	G	14: 53,763,472	I47V	probably benign	Het
Tsc22d4	T	C	5: 137,762,644	V109A	possibly damaging	Het
Ttl	G	A	2: 129,068,915	R73H	probably damaging	Het
Usp34	C	T	11: 23,367,491	T850I	possibly damaging	Het
Vdac3	T	C	8: 22,580,475	Y140C	probably damaging	Het
Vmn2r120	T	C	17: 57,536,659	R62G	probably benign	Het
Vmn2r17	T	A	5: 109,429,465	Y461N	probably damaging	Het
Wt1	T	A	2: 105,172,267	F493I	probably damaging	Het

Other mutations in Spast

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02226:Spast	APN	17	74372339	splice site	probably benign
R0671:Spast	UTSW	17	74339451	splice site	probably benign
R1170:Spast	UTSW	17	74381968	critical splice acceptor site	probably null
R1698:Spast	UTSW	17	74356160	nonsense	probably null
R2076:Spast	UTSW	17	74352031	missense	probably damaging	1.00
R4334:Spast	UTSW	17	74352015	missense	probably damaging	1.00
R4765:Spast	UTSW	17	74369216	missense	probably damaging	1.00
R5002:Spast	UTSW	17	74369226	nonsense	probably null
R5911:Spast	UTSW	17	74387063	missense	probably benign	0.00
R6073:Spast	UTSW	17	74373305	missense	probably damaging	1.00
R6183:Spast	UTSW	17	74373358	missense	probably damaging	0.99
R6450:Spast	UTSW	17	74368840	missense	probably benign	0.01
R6819:Spast	UTSW	17	74367286	missense	possibly damaging	0.47
R7349:Spast	UTSW	17	74373324	missense	probably damaging	0.99
R7611:Spast	UTSW	17	74369203	missense	probably damaging	1.00
R7715:Spast	UTSW	17	74368926	missense	probably benign	0.01
R8348:Spast	UTSW	17	74359298	missense	probably benign	0.41
R8448:Spast	UTSW	17	74359298	missense	probably benign	0.41
R8698:Spast	UTSW	17	74359346	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGAGAAACACTGGGACTATAGTC -3'
(R):5'- AGGGCATGGCAGTACATTTGG -3'

Sequencing Primer
(F):5'- GGGACTATAGTCTCCCTCTTGG -3'
(R):5'- AGTACATTTGGTTTACTCCACCAGG -3'

Posted On

2018-10-18