Incidental Mutation 'R6821:Acsl5'
ID537655
Institutional Source Beutler Lab
Gene Symbol Acsl5
Ensembl Gene ENSMUSG00000024981
Gene Nameacyl-CoA synthetase long-chain family member 5
SynonymsFacl5, 1700030F05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6821 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location55251938-55297720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55288836 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 417 (I417T)
Ref Sequence ENSEMBL: ENSMUSP00000046585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043150] [ENSMUST00000225963] [ENSMUST00000226103]
Predicted Effect probably benign
Transcript: ENSMUST00000043150
AA Change: I417T

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000046585
Gene: ENSMUSG00000024981
AA Change: I417T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:AMP-binding 82 548 2.7e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225963
Predicted Effect probably benign
Transcript: ENSMUST00000226103
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in uterus and spleen, and in trace amounts in normal brain, but has markedly increased levels in malignant gliomas. This gene functions in mediating fatty acid-induced glioma cell growth. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit decreased mean bone mineral content and density measurements when compared with controls. A notably decreased mean platelet count is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A C 15: 11,152,048 K208T probably benign Het
Adamts8 T A 9: 30,956,626 L582Q probably benign Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Ano9 A T 7: 141,107,256 F357I possibly damaging Het
Aox3 T C 1: 58,150,388 V416A probably benign Het
Arhgap21 A C 2: 20,848,848 F1901C probably benign Het
Atp8b2 A T 3: 89,948,173 F506I probably damaging Het
Atp9b A T 18: 80,847,248 L292H probably damaging Het
C2cd5 A G 6: 143,017,986 V891A probably damaging Het
Ccnt2 T C 1: 127,803,335 S650P probably damaging Het
Cdhr3 T A 12: 33,035,045 N791Y probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
D630003M21Rik A C 2: 158,204,774 L761R probably damaging Het
Draxin G T 4: 148,115,691 Q101K possibly damaging Het
Dtx3l A T 16: 35,933,060 L392Q probably damaging Het
Eif3d A G 15: 77,961,655 S389P possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha4 T C 1: 77,382,945 N757S possibly damaging Het
Fam228b T C 12: 4,763,083 I96V probably benign Het
Gars A G 6: 55,079,338 E728G probably benign Het
Gldn T C 9: 54,338,770 M535T probably benign Het
Gm13089 A T 4: 143,699,304 L23* probably null Het
Gm47985 A G 1: 151,183,036 T143A possibly damaging Het
Gpr6 T C 10: 41,071,008 T193A probably benign Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hecw1 T A 13: 14,264,134 Y1315F probably damaging Het
Hs3st2 A G 7: 121,500,522 D197G possibly damaging Het
Igsf9 T C 1: 172,484,493 I2T probably benign Het
Ints9 A G 14: 65,037,458 E621G probably benign Het
Itm2b G A 14: 73,366,467 P47S probably benign Het
Map10 A G 8: 125,670,399 K177R probably benign Het
Mdh2 T C 5: 135,789,671 F260S possibly damaging Het
Mtmr11 A G 3: 96,170,407 T573A probably benign Het
Mycbp2 A T 14: 103,139,409 I3812N probably damaging Het
Myo15 A G 11: 60,524,475 N3403S probably damaging Het
Nvl G A 1: 181,126,970 Q343* probably null Het
Ocstamp A T 2: 165,397,922 S115T probably benign Het
Olfr632 A T 7: 103,937,586 I69F probably benign Het
Otoa G A 7: 121,092,847 probably null Het
Pcdhb20 A T 18: 37,506,122 N567I probably damaging Het
Pgm5 A T 19: 24,861,647 V48E possibly damaging Het
Phlpp1 T A 1: 106,386,444 S1182R probably damaging Het
Pik3r4 T A 9: 105,650,606 L386Q probably damaging Het
Pop1 A G 15: 34,508,639 K287E possibly damaging Het
Rad54b A G 4: 11,612,777 D803G probably damaging Het
Rbm26 G A 14: 105,116,964 probably benign Het
Rspry1 C T 8: 94,635,431 Q113* probably null Het
Siah2 T A 3: 58,691,770 S16C probably benign Het
Sirpa C A 2: 129,630,097 D481E probably damaging Het
Slc38a7 A C 8: 95,844,920 D227E probably benign Het
Smc5 A G 19: 23,242,787 V438A probably benign Het
Spast A G 17: 74,351,962 E108G probably benign Het
Speg A G 1: 75,417,903 E1752G possibly damaging Het
Tanc2 T G 11: 105,886,490 probably null Het
Tgfbi T C 13: 56,626,137 I243T possibly damaging Het
Tlr12 T C 4: 128,616,892 S522G possibly damaging Het
Trav14-3 A G 14: 53,763,472 I47V probably benign Het
Tsc22d4 T C 5: 137,762,644 V109A possibly damaging Het
Ttl G A 2: 129,068,915 R73H probably damaging Het
Usp34 C T 11: 23,367,491 T850I possibly damaging Het
Vdac3 T C 8: 22,580,475 Y140C probably damaging Het
Vmn2r120 T C 17: 57,536,659 R62G probably benign Het
Vmn2r17 T A 5: 109,429,465 Y461N probably damaging Het
Wt1 T A 2: 105,172,267 F493I probably damaging Het
Other mutations in Acsl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Acsl5 APN 19 55272833 missense probably benign 0.02
IGL02792:Acsl5 APN 19 55293731 critical splice donor site probably null
lyrebird UTSW 19 55272819 nonsense probably null
paradise UTSW 19 55278183 missense
sharkey UTSW 19 55277973 critical splice donor site probably null
IGL02796:Acsl5 UTSW 19 55278169 nonsense probably null
R0206:Acsl5 UTSW 19 55280569 missense probably benign
R0400:Acsl5 UTSW 19 55293711 missense probably damaging 0.99
R0418:Acsl5 UTSW 19 55272806 missense probably benign 0.16
R0571:Acsl5 UTSW 19 55288911 intron probably benign
R0626:Acsl5 UTSW 19 55284472 missense probably benign 0.00
R0792:Acsl5 UTSW 19 55280492 missense probably benign 0.01
R1144:Acsl5 UTSW 19 55291843 missense probably damaging 1.00
R1477:Acsl5 UTSW 19 55291472 missense probably benign 0.23
R1522:Acsl5 UTSW 19 55280492 missense probably benign 0.01
R1927:Acsl5 UTSW 19 55278154 missense probably benign 0.37
R2495:Acsl5 UTSW 19 55293599 nonsense probably null
R4153:Acsl5 UTSW 19 55281463 missense probably benign 0.23
R4570:Acsl5 UTSW 19 55291774 missense probably damaging 0.99
R4721:Acsl5 UTSW 19 55280530 missense probably benign 0.00
R4834:Acsl5 UTSW 19 55280559 missense probably benign 0.00
R5270:Acsl5 UTSW 19 55294218 missense possibly damaging 0.50
R5360:Acsl5 UTSW 19 55291160 nonsense probably null
R5436:Acsl5 UTSW 19 55279565 critical splice donor site probably null
R5458:Acsl5 UTSW 19 55294230 missense probably damaging 1.00
R5479:Acsl5 UTSW 19 55280462 missense probably damaging 1.00
R5812:Acsl5 UTSW 19 55294836 missense probably benign 0.01
R6232:Acsl5 UTSW 19 55280501 missense possibly damaging 0.69
R6874:Acsl5 UTSW 19 55291863 missense probably damaging 1.00
R7030:Acsl5 UTSW 19 55272819 nonsense probably null
R7156:Acsl5 UTSW 19 55268828 splice site probably null
R7293:Acsl5 UTSW 19 55291210 missense probably damaging 0.98
R7543:Acsl5 UTSW 19 55278183 missense
R7728:Acsl5 UTSW 19 55287853 nonsense probably null
R7977:Acsl5 UTSW 19 55277973 critical splice donor site probably null
R7987:Acsl5 UTSW 19 55277973 critical splice donor site probably null
R8017:Acsl5 UTSW 19 55268796 missense probably benign
R8221:Acsl5 UTSW 19 55268830 critical splice donor site probably null
R8527:Acsl5 UTSW 19 55291827 missense probably damaging 1.00
R8542:Acsl5 UTSW 19 55291827 missense probably damaging 1.00
X0013:Acsl5 UTSW 19 55293664 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGATGGCTCCAATAGAAAGC -3'
(R):5'- GGGAGTTTTGGAACCCTGAC -3'

Sequencing Primer
(F):5'- GGCTCCAATAGAAAGCATTTTAAGTG -3'
(R):5'- GGAACCCTGACTCCATTTATGTAAAG -3'
Posted On2018-10-18