Incidental Mutation 'R6822:Entpd3'
ID537679
Institutional Source Beutler Lab
Gene Symbol Entpd3
Ensembl Gene ENSMUSG00000041608
Gene Nameectonucleoside triphosphate diphosphohydrolase 3
SynonymsHB6, Cd39l3, NTPDase-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R6822 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location120539818-120568327 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 120562038 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047687]
Predicted Effect probably null
Transcript: ENSMUST00000047687
SMART Domains Protein: ENSMUSP00000036830
Gene: ENSMUSG00000041608

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:GDA1_CD39 49 483 4.3e-102 PFAM
transmembrane domain 486 508 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 94% (46/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a plasma membrane-bound divalent cation-dependent E-type nucleotidase. The encoded protein is involved in the regulation of extracellular levels of ATP by hydrolysis of it and other nucleotides. Multiple transcript variants have been described. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no deficits in nucleotide hydrolysis or alterations in nociceptive behaviors except for a modest reduction in beta-alanine-mediated itch behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 G A 11: 102,776,675 R687Q possibly damaging Het
AI987944 A G 7: 41,374,808 L249P probably damaging Het
Ankrd28 T A 14: 31,736,840 probably null Het
Bahcc1 T C 11: 120,287,721 S2369P probably damaging Het
Birc6 T C 17: 74,580,382 S902P possibly damaging Het
Birc6 A T 17: 74,598,044 K1277N probably damaging Het
Brwd1 T C 16: 96,041,274 E821G probably benign Het
Cct8l1 T C 5: 25,517,939 S551P possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Cyp2c39 A T 19: 39,536,817 D188V probably damaging Het
Dclk3 G T 9: 111,439,337 A25S probably benign Het
Dpep2 A T 8: 105,985,241 M518K probably benign Het
Dst T C 1: 34,275,674 V6462A probably damaging Het
Epm2aip1 T C 9: 111,272,556 V199A probably damaging Het
Fam193b A G 13: 55,541,691 probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fat1 A G 8: 45,026,404 D2829G probably damaging Het
Fcgbp T A 7: 28,107,356 Y2250N probably damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
H2-Aa C T 17: 34,287,677 probably null Het
Igsf9 T A 1: 172,497,163 S883T possibly damaging Het
Kcnh7 T G 2: 62,787,904 I414L probably damaging Het
Kcnma1 T C 14: 24,003,744 probably null Het
Kcnmb1 T C 11: 33,964,686 probably benign Het
Kmt2d A G 15: 98,849,459 probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Map3k13 G A 16: 21,922,263 S780N probably benign Het
Nlgn1 T C 3: 26,133,647 T30A probably benign Het
Nucb1 A G 7: 45,498,865 F175L probably damaging Het
Pax6 T A 2: 105,685,923 V182E probably benign Het
Ptger1 A G 8: 83,668,650 D252G probably benign Het
Rexo4 T C 2: 26,960,271 D275G probably damaging Het
Ripk4 T C 16: 97,746,036 D342G probably damaging Het
Rpl10l A T 12: 66,284,213 C49S possibly damaging Het
Sema7a T C 9: 57,960,336 F457S probably damaging Het
Shank3 G A 15: 89,531,627 D155N probably damaging Het
Smpd3 G A 8: 106,265,964 probably benign Het
Smpd4 T C 16: 17,640,233 V465A probably damaging Het
Sohlh2 T C 3: 55,207,686 V364A probably damaging Het
Sos2 C T 12: 69,650,649 R99Q probably damaging Het
Spry2 G A 14: 105,893,357 Q132* probably null Het
Tbx19 G T 1: 165,140,140 P346Q probably damaging Het
Tdrd6 A G 17: 43,627,215 Y981H probably damaging Het
Tinag T C 9: 77,031,702 K165E probably benign Het
Tubb4a A T 17: 57,080,904 I374N probably damaging Het
Umodl1 C T 17: 30,986,554 Q708* probably null Het
Vmn2r3 A T 3: 64,287,455 V14E probably benign Het
Zfp82 G A 7: 30,056,287 L457F probably damaging Het
Other mutations in Entpd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Entpd3 APN 9 120561941 missense probably damaging 1.00
R0054:Entpd3 UTSW 9 120557542 missense probably damaging 0.99
R0265:Entpd3 UTSW 9 120558481 missense probably damaging 1.00
R0417:Entpd3 UTSW 9 120557421 missense probably damaging 0.99
R0607:Entpd3 UTSW 9 120557405 missense possibly damaging 0.63
R1028:Entpd3 UTSW 9 120558361 missense probably benign 0.06
R1449:Entpd3 UTSW 9 120566489 missense probably damaging 1.00
R1490:Entpd3 UTSW 9 120554159 missense probably benign 0.03
R1846:Entpd3 UTSW 9 120558375 missense probably benign 0.33
R1848:Entpd3 UTSW 9 120558419 missense probably damaging 1.00
R2125:Entpd3 UTSW 9 120555654 missense probably damaging 1.00
R3810:Entpd3 UTSW 9 120562002 missense probably benign 0.00
R5101:Entpd3 UTSW 9 120566542 makesense probably null
R5109:Entpd3 UTSW 9 120566314 missense possibly damaging 0.95
R6968:Entpd3 UTSW 9 120560656 missense probably benign 0.01
R7107:Entpd3 UTSW 9 120560599 missense probably damaging 1.00
R7132:Entpd3 UTSW 9 120561020 missense probably benign 0.00
R7310:Entpd3 UTSW 9 120560755 critical splice donor site probably null
R7776:Entpd3 UTSW 9 120558502 missense probably damaging 1.00
R7831:Entpd3 UTSW 9 120543959 missense probably damaging 1.00
R7871:Entpd3 UTSW 9 120560586 missense possibly damaging 0.81
R7914:Entpd3 UTSW 9 120543959 missense probably damaging 1.00
R7954:Entpd3 UTSW 9 120560586 missense possibly damaging 0.81
X0017:Entpd3 UTSW 9 120555749 missense probably benign 0.41
X0024:Entpd3 UTSW 9 120561900 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGAGAGTCACCTGTCTGCTC -3'
(R):5'- AGTTCTTTGGCACTGACTGG -3'

Sequencing Primer
(F):5'- GTCTGCTCCCCCTCTTGG -3'
(R):5'- TTTGGCACTGACTGGGCTCC -3'
Posted On2018-10-18