Mutagenetix > Incidental Mutations

Incidental Mutation 'R6823:Cep250'

537710

Institutional Source

Beutler Lab

Gene Symbol

Cep250

Ensembl Gene

ENSMUSG00000038241

Gene Name

centrosomal protein 250

Synonyms

Cep2, Inmp, B230210E21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6823 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

155956458-155998900 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 155981459 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1010 (D1010G)

Ref Sequence

ENSEMBL: ENSMUSP00000038255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039994] [ENSMUST00000094421] [ENSMUST00000109619] [ENSMUST00000124812] [ENSMUST00000128683]

Predicted Effect

probably benign
Transcript: ENSMUST00000039994
AA Change: D1010G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000038255
Gene: ENSMUSG00000038241
AA Change: D1010G

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	215	4.2e-56	PFAM
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	327	N/A	INTRINSIC
internal_repeat_1	444	460	1.47e-18	PROSPERO
internal_repeat_1	465	481	1.47e-18	PROSPERO
low complexity region	495	506	N/A	INTRINSIC
low complexity region	557	580	N/A	INTRINSIC
low complexity region	583	595	N/A	INTRINSIC
low complexity region	635	650	N/A	INTRINSIC
low complexity region	669	677	N/A	INTRINSIC
low complexity region	688	703	N/A	INTRINSIC
low complexity region	708	719	N/A	INTRINSIC
low complexity region	896	914	N/A	INTRINSIC
low complexity region	990	1007	N/A	INTRINSIC
low complexity region	1043	1053	N/A	INTRINSIC
low complexity region	1138	1143	N/A	INTRINSIC
low complexity region	1182	1195	N/A	INTRINSIC
coiled coil region	1257	1687	N/A	INTRINSIC
low complexity region	1872	1895	N/A	INTRINSIC
low complexity region	1919	1933	N/A	INTRINSIC
low complexity region	1941	1960	N/A	INTRINSIC
internal_repeat_2	2002	2052	3.9e-6	PROSPERO
coiled coil region	2068	2169	N/A	INTRINSIC
coiled coil region	2196	2217	N/A	INTRINSIC
coiled coil region	2251	2310	N/A	INTRINSIC
low complexity region	2325	2338	N/A	INTRINSIC
coiled coil region	2340	2366	N/A	INTRINSIC
low complexity region	2379	2388	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000094421
AA Change: D990G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000091988
Gene: ENSMUSG00000038241
AA Change: D990G

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	215	5.4e-56	PFAM
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	357	N/A	INTRINSIC
coiled coil region	400	1165	N/A	INTRINSIC
coiled coil region	1237	1667	N/A	INTRINSIC
low complexity region	1852	1875	N/A	INTRINSIC
low complexity region	1899	1913	N/A	INTRINSIC
low complexity region	1921	1940	N/A	INTRINSIC
internal_repeat_1	1982	2032	3.35e-6	PROSPERO
coiled coil region	2048	2149	N/A	INTRINSIC
coiled coil region	2176	2197	N/A	INTRINSIC
coiled coil region	2231	2290	N/A	INTRINSIC
low complexity region	2305	2318	N/A	INTRINSIC
coiled coil region	2320	2346	N/A	INTRINSIC
low complexity region	2359	2368	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109619
AA Change: D1011G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000105248
Gene: ENSMUSG00000038241
AA Change: D1011G

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	214	4.1e-60	PFAM
low complexity region	215	225	N/A	INTRINSIC
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	357	N/A	INTRINSIC
internal_repeat_1	445	461	1.51e-18	PROSPERO
internal_repeat_1	466	482	1.51e-18	PROSPERO
low complexity region	496	507	N/A	INTRINSIC
low complexity region	558	581	N/A	INTRINSIC
low complexity region	584	596	N/A	INTRINSIC
low complexity region	636	651	N/A	INTRINSIC
low complexity region	670	678	N/A	INTRINSIC
low complexity region	689	704	N/A	INTRINSIC
low complexity region	709	720	N/A	INTRINSIC
low complexity region	897	915	N/A	INTRINSIC
low complexity region	991	1008	N/A	INTRINSIC
low complexity region	1044	1054	N/A	INTRINSIC
low complexity region	1139	1144	N/A	INTRINSIC
low complexity region	1183	1196	N/A	INTRINSIC
coiled coil region	1258	1688	N/A	INTRINSIC
low complexity region	1873	1896	N/A	INTRINSIC
low complexity region	1920	1934	N/A	INTRINSIC
low complexity region	1942	1961	N/A	INTRINSIC
internal_repeat_2	2003	2053	3.95e-6	PROSPERO
coiled coil region	2069	2170	N/A	INTRINSIC
coiled coil region	2197	2218	N/A	INTRINSIC
coiled coil region	2252	2311	N/A	INTRINSIC
low complexity region	2326	2339	N/A	INTRINSIC
coiled coil region	2341	2367	N/A	INTRINSIC
low complexity region	2380	2389	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124812

Predicted Effect

probably benign
Transcript: ENSMUST00000128683

SMART Domains

Protein: ENSMUSP00000119845
Gene: ENSMUSG00000038241

Domain	Start	End	E-Value	Type
coiled coil region	2	37	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156355

SMART Domains

Protein: ENSMUSP00000122223
Gene: ENSMUSG00000038241

Domain	Start	End	E-Value	Type
coiled coil region	12	47	N/A	INTRINSIC
coiled coil region	119	223	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

98% (81/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core centrosomal protein required for centriole-centriole cohesion during interphase of the cell cycle. The encoded protein dissociates from the centrosomes when parental centrioles separate at the beginning of mitosis. The protein associates with and is phosphorylated by NIMA-related kinase 2, which is also associated with the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	T	G	15: 64,754,886		probably null	Het
Adgrv1	A	G	13: 81,557,081	F1537L	probably damaging	Het
Aggf1	T	C	13: 95,364,723	S384G	probably benign	Het
Anxa8	A	T	14: 34,094,765	D204V	possibly damaging	Het
Asap3	A	T	4: 136,227,572	E71V	possibly damaging	Het
BC024139	T	C	15: 76,119,746	*773W	probably null	Het
Bckdhb	T	C	9: 83,953,761	V106A	possibly damaging	Het
Chrd	T	A	16: 20,734,736	L243Q	probably damaging	Het
Cib2	G	T	9: 54,549,891	L30I	possibly damaging	Het
Cpsf7	T	A	19: 10,532,884	L113*	probably null	Het
Cubn	T	A	2: 13,445,029	I895L	probably benign	Het
Cyp24a1	C	A	2: 170,487,979	R351I	probably benign	Het
Cyp2a12	A	T	7: 27,034,156	D320V	possibly damaging	Het
Dact1	C	G	12: 71,317,939	P498R	probably benign	Het
Diaph1	T	A	18: 37,876,383		probably null	Het
Dnah7a	A	T	1: 53,456,704	I3198N	probably benign	Het
Dopey2	A	T	16: 93,755,485	I271F	possibly damaging	Het
Erich3	C	A	3: 154,727,437	F349L	probably damaging	Het
Fam187b	G	C	7: 30,989,290	V358L	probably benign	Het
Fat4	T	A	3: 38,983,939	H3913Q	probably benign	Het
Fbxw7	G	C	3: 84,958,627	E118D	probably benign	Het
Fgf1	A	G	18: 38,847,108	I71T	probably damaging	Het
Fryl	A	T	5: 73,065,217	I2007K	probably damaging	Het
Galnt2	C	G	8: 124,324,011	P130A	probably benign	Het
H1fx	G	A	6: 87,981,302	R19C	probably damaging	Het
Hmga2	A	C	10: 120,476,024	S14A	possibly damaging	Het
Hoxb4	C	T	11: 96,318,654		probably benign	Het
Hr	A	T	14: 70,565,374	I756F	probably damaging	Het
Hrasls5	A	T	19: 7,639,496		probably benign	Het
Hspa1b	A	T	17: 34,958,185	S275T	probably benign	Het
Ikbkap	A	G	4: 56,787,939	Y331H	probably damaging	Het
Kcnh1	T	C	1: 192,505,289	*99R	probably null	Het
Kit	C	A	5: 75,652,649	L864I	probably benign	Het
Klk14	A	T	7: 43,694,456	K196*	probably null	Het
Lmod1	A	G	1: 135,325,167	N53S	probably damaging	Het
Myh13	T	C	11: 67,356,158	M1235T	probably benign	Het
Neurl3	T	A	1: 36,268,704	K175*	probably null	Het
Nlgn2	T	A	11: 69,825,924	K597M	probably damaging	Het
Npdc1	T	C	2: 25,409,109	M306T	probably damaging	Het
Obscn	C	T	11: 59,067,943		probably null	Het
Olfr404-ps1	T	C	11: 74,239,696	L44P	probably damaging	Het
Olfr553	G	A	7: 102,614,486	L168F	probably damaging	Het
Olfr913	T	C	9: 38,594,905	I228T	possibly damaging	Het
Pbrm1	A	T	14: 31,084,790	Y1042F	probably damaging	Het
Pclo	T	A	5: 14,677,907		probably benign	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Phf12	C	T	11: 78,022,511	Q430*	probably null	Het
Pld3	C	T	7: 27,535,897	R302H	probably damaging	Het
Plekha5	T	C	6: 140,525,858	S112P	probably benign	Het
Pmfbp1	T	A	8: 109,530,307	S548T	possibly damaging	Het
Ppa1	A	T	10: 61,667,603	I220F	probably damaging	Het
Ppp2r3d	A	G	9: 124,439,078		probably benign	Het
Psmg2	A	T	18: 67,648,857	E164D	possibly damaging	Het
Rarb	T	C	14: 16,443,824	R155G	probably damaging	Het
Rnf215	T	C	11: 4,136,609	L162S	probably damaging	Het
Rsf1	GGCG	GGCGACGGCCGCG	7: 97,579,906		probably benign	Het
Rtkn2	G	A	10: 68,026,632	V330M	probably damaging	Het
Slc16a4	A	T	3: 107,311,498	I472F	probably benign	Het
Snx14	T	C	9: 88,394,382	N617D	possibly damaging	Het
Spire2	T	C	8: 123,356,727	V150A	probably damaging	Het
Sptbn1	C	A	11: 30,114,787	R1904M	probably damaging	Het
Swap70	A	G	7: 110,281,303	E575G	possibly damaging	Het
Tbxas1	A	T	6: 38,919,153	M1L	possibly damaging	Het
Tenm3	A	T	8: 48,256,837	V1688D	probably damaging	Het
Tgfbr3	A	T	5: 107,149,914	S207T	probably damaging	Het
Timm44	A	G	8: 4,267,282	F248L	probably damaging	Het
Tmem161a	T	C	8: 70,181,199	L170P	probably damaging	Het
Tmem63a	A	T	1: 180,960,470	Y263F	possibly damaging	Het
Tnfsf9	C	A	17: 57,105,513	L28I	probably benign	Het
Tph2	T	A	10: 115,174,106	N183I	probably benign	Het
Ttyh1	T	C	7: 4,122,529	I60T	probably damaging	Het
Ubn1	T	G	16: 5,064,547	S48A	probably damaging	Het
Ubr5	T	C	15: 37,989,598	N2019S	probably benign	Het
Wbp2	T	C	11: 116,086,910	N6D	probably benign	Het
Wdr59	T	A	8: 111,459,040	E810V	possibly damaging	Het
Wiz	T	C	17: 32,360,421	D220G	probably damaging	Het
Yipf7	A	G	5: 69,517,070	L244P	probably damaging	Het
Zdhhc17	T	C	10: 110,955,111	T366A	possibly damaging	Het
Zfp169	A	T	13: 48,490,996		probably benign	Het
Zfp707	C	T	15: 75,969,723		probably benign	Het
Zfp788	A	G	7: 41,649,560	H540R	probably damaging	Het

Other mutations in Cep250

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Cep250	APN	2	155991329	missense	probably benign	0.00
IGL01077:Cep250	APN	2	155962134	missense	probably damaging	1.00
IGL01084:Cep250	APN	2	155998393	missense	probably benign	0.00
IGL01400:Cep250	APN	2	155998291	missense	possibly damaging	0.78
IGL01570:Cep250	APN	2	155967663	splice site	probably benign
IGL01583:Cep250	APN	2	155976149	missense	probably damaging	0.99
IGL01590:Cep250	APN	2	155992317	missense	possibly damaging	0.80
IGL01647:Cep250	APN	2	155983376	missense	probably benign	0.02
IGL01959:Cep250	APN	2	155983359	missense	possibly damaging	0.63
IGL02066:Cep250	APN	2	155976521	missense	probably damaging	1.00
IGL02219:Cep250	APN	2	155991594	missense	probably benign	0.26
IGL02322:Cep250	APN	2	155990328	missense	probably damaging	1.00
IGL02728:Cep250	APN	2	155983278	unclassified	probably benign
IGL02955:Cep250	APN	2	155975756	missense	probably benign	0.01
IGL03369:Cep250	APN	2	155990271	missense	probably benign	0.00
R0366:Cep250	UTSW	2	155988401	missense	probably benign	0.00
R0403:Cep250	UTSW	2	155992349	missense	probably damaging	0.99
R0441:Cep250	UTSW	2	155972004	missense	possibly damaging	0.82
R0482:Cep250	UTSW	2	155964974	splice site	probably benign
R0507:Cep250	UTSW	2	155992532	missense	possibly damaging	0.60
R0614:Cep250	UTSW	2	155970097	nonsense	probably null
R0855:Cep250	UTSW	2	155964111	missense	probably damaging	1.00
R0973:Cep250	UTSW	2	155964289	splice site	probably benign
R1137:Cep250	UTSW	2	155990840	missense	probably benign	0.05
R1270:Cep250	UTSW	2	155990681	missense	probably benign	0.01
R1313:Cep250	UTSW	2	155972079	missense	probably damaging	0.98
R1313:Cep250	UTSW	2	155972079	missense	probably damaging	0.98
R1470:Cep250	UTSW	2	155991075	missense	probably damaging	0.99
R1470:Cep250	UTSW	2	155991075	missense	probably damaging	0.99
R1703:Cep250	UTSW	2	155965546	missense	probably benign	0.23
R1705:Cep250	UTSW	2	155963786	missense	probably damaging	1.00
R1740:Cep250	UTSW	2	155973356	missense	probably damaging	0.99
R1796:Cep250	UTSW	2	155992187	missense	possibly damaging	0.88
R1897:Cep250	UTSW	2	155976095	missense	probably damaging	1.00
R1900:Cep250	UTSW	2	155985374	critical splice donor site	probably null
R1958:Cep250	UTSW	2	155976381	splice site	probably null
R1974:Cep250	UTSW	2	155989504	missense	probably damaging	0.96
R2015:Cep250	UTSW	2	155981453	missense	probably damaging	0.96
R2033:Cep250	UTSW	2	155970892	missense	probably damaging	0.99
R2224:Cep250	UTSW	2	155991817	missense	possibly damaging	0.94
R2266:Cep250	UTSW	2	155976170	missense	probably benign	0.13
R2278:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2332:Cep250	UTSW	2	155990607	missense	probably damaging	1.00
R2364:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2366:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2367:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2385:Cep250	UTSW	2	155974341	missense	probably damaging	1.00
R2830:Cep250	UTSW	2	155983316	missense	probably benign	0.00
R2895:Cep250	UTSW	2	155992122	missense	probably benign	0.00
R2965:Cep250	UTSW	2	155994878	missense	probably benign	0.44
R2966:Cep250	UTSW	2	155994878	missense	probably benign	0.44
R3016:Cep250	UTSW	2	155991288	missense	probably damaging	1.00
R3052:Cep250	UTSW	2	155991048	missense	probably damaging	0.99
R3424:Cep250	UTSW	2	155981461	missense	probably benign	0.02
R3930:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4085:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4087:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4088:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4090:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4110:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4355:Cep250	UTSW	2	155991525	missense	probably damaging	1.00
R4601:Cep250	UTSW	2	155962053	missense	probably benign	0.10
R4721:Cep250	UTSW	2	155970199	missense	probably damaging	1.00
R4995:Cep250	UTSW	2	155988316	missense	probably damaging	1.00
R5053:Cep250	UTSW	2	155962928	missense	possibly damaging	0.77
R5090:Cep250	UTSW	2	155976404	missense	probably damaging	1.00
R5744:Cep250	UTSW	2	155981474	missense	possibly damaging	0.60
R5775:Cep250	UTSW	2	155969374	missense	possibly damaging	0.92
R5986:Cep250	UTSW	2	155979277	missense	probably damaging	1.00
R6112:Cep250	UTSW	2	155994583	missense	possibly damaging	0.95
R6152:Cep250	UTSW	2	155981438	missense	possibly damaging	0.94
R6859:Cep250	UTSW	2	155992526	missense	probably benign	0.24
R6900:Cep250	UTSW	2	155996270	critical splice acceptor site	probably null
R7107:Cep250	UTSW	2	155995394	missense	probably benign	0.00
R7131:Cep250	UTSW	2	155965077	missense	probably damaging	1.00
R7178:Cep250	UTSW	2	155973455	nonsense	probably null
R7241:Cep250	UTSW	2	155991552	missense	probably benign	0.20
R7264:Cep250	UTSW	2	155979151	missense	probably damaging	0.99
R7290:Cep250	UTSW	2	155992762	missense	probably benign	0.03
R7367:Cep250	UTSW	2	155969307	missense	probably benign	0.00
R7397:Cep250	UTSW	2	155981411	missense	probably damaging	0.99
R7768:Cep250	UTSW	2	155986009	missense
R7823:Cep250	UTSW	2	155965416	missense	possibly damaging	0.89
R8152:Cep250	UTSW	2	155969307	missense	probably benign	0.00
R8331:Cep250	UTSW	2	155990253	missense	probably damaging	1.00
X0061:Cep250	UTSW	2	155961985	missense	probably benign	0.05
Z1177:Cep250	UTSW	2	155976467	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AAAGTATGCATTGCTACTTCCTGC -3'
(R):5'- CATGCTCAGCTCTGAACACC -3'

Sequencing Primer
(F):5'- GCCTCAGTTTCTGCCAACTCAATAG -3'
(R):5'- GAACACCCTTCAACTCTGCATTTAG -3'

Posted On

2018-10-18