Incidental Mutation 'R6823:Cyp24a1'
ID537711
Institutional Source Beutler Lab
Gene Symbol Cyp24a1
Ensembl Gene ENSMUSG00000038567
Gene Namecytochrome P450, family 24, subfamily a, polypeptide 1
SynonymsCP24, 24-OHase, Cyp24, 25-hydroxyvitamin D-24-hydroxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R6823 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location170482708-170497145 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 170487979 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Isoleucine at position 351 (R351I)
Ref Sequence ENSEMBL: ENSMUSP00000047954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038824]
Predicted Effect probably benign
Transcript: ENSMUST00000038824
AA Change: R351I

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000047954
Gene: ENSMUSG00000038567
AA Change: R351I

DomainStartEndE-ValueType
Pfam:p450 58 511 6e-108 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: The protein encoded by this gene localizes to the mitochondrion, where it degrades calcitriol to calcitetrol. This gene is upregulated by binding of calcitriol to the upstream regulatory region and to a downstream enhancer region, thereby allowing calcitriol to autoregulate its concentration in the cell. The encoded protein may also play a role in calcium homeostasis. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruption of this gene suffer a 50% mortality rate between birth and weaning. abnormalities are seen in the development of membranous bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,754,886 probably null Het
Adgrv1 A G 13: 81,557,081 F1537L probably damaging Het
Aggf1 T C 13: 95,364,723 S384G probably benign Het
Anxa8 A T 14: 34,094,765 D204V possibly damaging Het
Asap3 A T 4: 136,227,572 E71V possibly damaging Het
BC024139 T C 15: 76,119,746 *773W probably null Het
Bckdhb T C 9: 83,953,761 V106A possibly damaging Het
Cep250 A G 2: 155,981,459 D1010G probably benign Het
Chrd T A 16: 20,734,736 L243Q probably damaging Het
Cib2 G T 9: 54,549,891 L30I possibly damaging Het
Cpsf7 T A 19: 10,532,884 L113* probably null Het
Cubn T A 2: 13,445,029 I895L probably benign Het
Cyp2a12 A T 7: 27,034,156 D320V possibly damaging Het
Dact1 C G 12: 71,317,939 P498R probably benign Het
Diaph1 T A 18: 37,876,383 probably null Het
Dnah7a A T 1: 53,456,704 I3198N probably benign Het
Dopey2 A T 16: 93,755,485 I271F possibly damaging Het
Erich3 C A 3: 154,727,437 F349L probably damaging Het
Fam187b G C 7: 30,989,290 V358L probably benign Het
Fat4 T A 3: 38,983,939 H3913Q probably benign Het
Fbxw7 G C 3: 84,958,627 E118D probably benign Het
Fgf1 A G 18: 38,847,108 I71T probably damaging Het
Fryl A T 5: 73,065,217 I2007K probably damaging Het
Galnt2 C G 8: 124,324,011 P130A probably benign Het
H1fx G A 6: 87,981,302 R19C probably damaging Het
Hmga2 A C 10: 120,476,024 S14A possibly damaging Het
Hoxb4 C T 11: 96,318,654 probably benign Het
Hr A T 14: 70,565,374 I756F probably damaging Het
Hrasls5 A T 19: 7,639,496 probably benign Het
Hspa1b A T 17: 34,958,185 S275T probably benign Het
Ikbkap A G 4: 56,787,939 Y331H probably damaging Het
Kcnh1 T C 1: 192,505,289 *99R probably null Het
Kit C A 5: 75,652,649 L864I probably benign Het
Klk14 A T 7: 43,694,456 K196* probably null Het
Lmod1 A G 1: 135,325,167 N53S probably damaging Het
Myh13 T C 11: 67,356,158 M1235T probably benign Het
Neurl3 T A 1: 36,268,704 K175* probably null Het
Nlgn2 T A 11: 69,825,924 K597M probably damaging Het
Npdc1 T C 2: 25,409,109 M306T probably damaging Het
Obscn C T 11: 59,067,943 probably null Het
Olfr404-ps1 T C 11: 74,239,696 L44P probably damaging Het
Olfr553 G A 7: 102,614,486 L168F probably damaging Het
Olfr913 T C 9: 38,594,905 I228T possibly damaging Het
Pbrm1 A T 14: 31,084,790 Y1042F probably damaging Het
Pclo T A 5: 14,677,907 probably benign Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Phf12 C T 11: 78,022,511 Q430* probably null Het
Pld3 C T 7: 27,535,897 R302H probably damaging Het
Plekha5 T C 6: 140,525,858 S112P probably benign Het
Pmfbp1 T A 8: 109,530,307 S548T possibly damaging Het
Ppa1 A T 10: 61,667,603 I220F probably damaging Het
Ppp2r3d A G 9: 124,439,078 probably benign Het
Psmg2 A T 18: 67,648,857 E164D possibly damaging Het
Rarb T C 14: 16,443,824 R155G probably damaging Het
Rnf215 T C 11: 4,136,609 L162S probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Rtkn2 G A 10: 68,026,632 V330M probably damaging Het
Slc16a4 A T 3: 107,311,498 I472F probably benign Het
Snx14 T C 9: 88,394,382 N617D possibly damaging Het
Spire2 T C 8: 123,356,727 V150A probably damaging Het
Sptbn1 C A 11: 30,114,787 R1904M probably damaging Het
Swap70 A G 7: 110,281,303 E575G possibly damaging Het
Tbxas1 A T 6: 38,919,153 M1L possibly damaging Het
Tenm3 A T 8: 48,256,837 V1688D probably damaging Het
Tgfbr3 A T 5: 107,149,914 S207T probably damaging Het
Timm44 A G 8: 4,267,282 F248L probably damaging Het
Tmem161a T C 8: 70,181,199 L170P probably damaging Het
Tmem63a A T 1: 180,960,470 Y263F possibly damaging Het
Tnfsf9 C A 17: 57,105,513 L28I probably benign Het
Tph2 T A 10: 115,174,106 N183I probably benign Het
Ttyh1 T C 7: 4,122,529 I60T probably damaging Het
Ubn1 T G 16: 5,064,547 S48A probably damaging Het
Ubr5 T C 15: 37,989,598 N2019S probably benign Het
Wbp2 T C 11: 116,086,910 N6D probably benign Het
Wdr59 T A 8: 111,459,040 E810V possibly damaging Het
Wiz T C 17: 32,360,421 D220G probably damaging Het
Yipf7 A G 5: 69,517,070 L244P probably damaging Het
Zdhhc17 T C 10: 110,955,111 T366A possibly damaging Het
Zfp169 A T 13: 48,490,996 probably benign Het
Zfp707 C T 15: 75,969,723 probably benign Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Cyp24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Cyp24a1 APN 2 170496566 missense probably damaging 1.00
IGL02187:Cyp24a1 APN 2 170494093 missense probably damaging 1.00
IGL02269:Cyp24a1 APN 2 170496572 missense probably damaging 1.00
IGL02273:Cyp24a1 APN 2 170496358 missense probably damaging 1.00
IGL03089:Cyp24a1 APN 2 170485966 missense probably damaging 1.00
R0359:Cyp24a1 UTSW 2 170491699 missense possibly damaging 0.94
R1037:Cyp24a1 UTSW 2 170491617 missense probably damaging 1.00
R1243:Cyp24a1 UTSW 2 170495406 missense probably benign 0.28
R1601:Cyp24a1 UTSW 2 170485691 missense possibly damaging 0.48
R1696:Cyp24a1 UTSW 2 170486043 missense probably benign 0.10
R1839:Cyp24a1 UTSW 2 170496741 missense probably benign
R1845:Cyp24a1 UTSW 2 170487917 missense probably benign 0.06
R4832:Cyp24a1 UTSW 2 170496178 missense probably benign 0.07
R5649:Cyp24a1 UTSW 2 170496309 missense possibly damaging 0.87
R6320:Cyp24a1 UTSW 2 170486784 missense probably benign 0.13
R6668:Cyp24a1 UTSW 2 170485885 critical splice donor site probably null
R6953:Cyp24a1 UTSW 2 170487946 missense probably benign
R7136:Cyp24a1 UTSW 2 170494143 missense probably benign 0.15
R7287:Cyp24a1 UTSW 2 170485906 missense probably damaging 1.00
R7831:Cyp24a1 UTSW 2 170485940 missense probably damaging 1.00
R7893:Cyp24a1 UTSW 2 170496516 critical splice donor site probably null
R8193:Cyp24a1 UTSW 2 170485702 missense probably damaging 1.00
R8206:Cyp24a1 UTSW 2 170491669 missense possibly damaging 0.83
R8296:Cyp24a1 UTSW 2 170490116 missense probably damaging 1.00
R8384:Cyp24a1 UTSW 2 170486769 critical splice donor site probably null
X0061:Cyp24a1 UTSW 2 170485990 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTCTGAGAGAATCCTTTTCTAGTGC -3'
(R):5'- CCTTTTGTGAGCCTGACGTC -3'

Sequencing Primer
(F):5'- GAGAATCCTTTTCTAGTGCTAAAGC -3'
(R):5'- CGGTCGTCGACAGACTCTATC -3'
Posted On2018-10-18