Incidental Mutation 'R6823:Fryl'
ID537720
Institutional Source Beutler Lab
Gene Symbol Fryl
Ensembl Gene ENSMUSG00000070733
Gene NameFRY like transcription coactivator
Synonyms2510002A14Rik, 2310004H21Rik, 9030227G01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.870) question?
Stock #R6823 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location73019987-73256619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73065217 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 2007 (I2007K)
Ref Sequence ENSEMBL: ENSMUSP00000098687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127]
Predicted Effect probably damaging
Transcript: ENSMUST00000094700
AA Change: I2007K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: I2007K

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 117 649 5.7e-176 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 896 1141 1.3e-5 PFAM
Pfam:MOR2-PAG1_mid 1145 1331 2e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1450 1.2e-5 PFAM
low complexity region 1476 1487 N/A INTRINSIC
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1590 1660 1.1e-5 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 3.2e-15 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2002 2255 9.9e-78 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101127
AA Change: I2007K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: I2007K

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 116 649 3e-172 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 898 1115 7.8e-6 PFAM
Pfam:MOR2-PAG1_mid 1147 1331 9.5e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1503 1.1e-5 PFAM
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1589 1664 6e-6 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 1.6e-14 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 1998 2260 4.4e-76 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201277
Predicted Effect
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (81/83)
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,754,886 probably null Het
Adgrv1 A G 13: 81,557,081 F1537L probably damaging Het
Aggf1 T C 13: 95,364,723 S384G probably benign Het
Anxa8 A T 14: 34,094,765 D204V possibly damaging Het
Asap3 A T 4: 136,227,572 E71V possibly damaging Het
BC024139 T C 15: 76,119,746 *773W probably null Het
Bckdhb T C 9: 83,953,761 V106A possibly damaging Het
Cep250 A G 2: 155,981,459 D1010G probably benign Het
Chrd T A 16: 20,734,736 L243Q probably damaging Het
Cib2 G T 9: 54,549,891 L30I possibly damaging Het
Cpsf7 T A 19: 10,532,884 L113* probably null Het
Cubn T A 2: 13,445,029 I895L probably benign Het
Cyp24a1 C A 2: 170,487,979 R351I probably benign Het
Cyp2a12 A T 7: 27,034,156 D320V possibly damaging Het
Dact1 C G 12: 71,317,939 P498R probably benign Het
Diaph1 T A 18: 37,876,383 probably null Het
Dnah7a A T 1: 53,456,704 I3198N probably benign Het
Dopey2 A T 16: 93,755,485 I271F possibly damaging Het
Erich3 C A 3: 154,727,437 F349L probably damaging Het
Fam187b G C 7: 30,989,290 V358L probably benign Het
Fat4 T A 3: 38,983,939 H3913Q probably benign Het
Fbxw7 G C 3: 84,958,627 E118D probably benign Het
Fgf1 A G 18: 38,847,108 I71T probably damaging Het
Galnt2 C G 8: 124,324,011 P130A probably benign Het
H1fx G A 6: 87,981,302 R19C probably damaging Het
Hmga2 A C 10: 120,476,024 S14A possibly damaging Het
Hoxb4 C T 11: 96,318,654 probably benign Het
Hr A T 14: 70,565,374 I756F probably damaging Het
Hrasls5 A T 19: 7,639,496 probably benign Het
Hspa1b A T 17: 34,958,185 S275T probably benign Het
Ikbkap A G 4: 56,787,939 Y331H probably damaging Het
Kcnh1 T C 1: 192,505,289 *99R probably null Het
Kit C A 5: 75,652,649 L864I probably benign Het
Klk14 A T 7: 43,694,456 K196* probably null Het
Lmod1 A G 1: 135,325,167 N53S probably damaging Het
Myh13 T C 11: 67,356,158 M1235T probably benign Het
Neurl3 T A 1: 36,268,704 K175* probably null Het
Nlgn2 T A 11: 69,825,924 K597M probably damaging Het
Npdc1 T C 2: 25,409,109 M306T probably damaging Het
Obscn C T 11: 59,067,943 probably null Het
Olfr404-ps1 T C 11: 74,239,696 L44P probably damaging Het
Olfr553 G A 7: 102,614,486 L168F probably damaging Het
Olfr913 T C 9: 38,594,905 I228T possibly damaging Het
Pbrm1 A T 14: 31,084,790 Y1042F probably damaging Het
Pclo T A 5: 14,677,907 probably benign Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Phf12 C T 11: 78,022,511 Q430* probably null Het
Pld3 C T 7: 27,535,897 R302H probably damaging Het
Plekha5 T C 6: 140,525,858 S112P probably benign Het
Pmfbp1 T A 8: 109,530,307 S548T possibly damaging Het
Ppa1 A T 10: 61,667,603 I220F probably damaging Het
Ppp2r3d A G 9: 124,439,078 probably benign Het
Psmg2 A T 18: 67,648,857 E164D possibly damaging Het
Rarb T C 14: 16,443,824 R155G probably damaging Het
Rnf215 T C 11: 4,136,609 L162S probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Rtkn2 G A 10: 68,026,632 V330M probably damaging Het
Slc16a4 A T 3: 107,311,498 I472F probably benign Het
Snx14 T C 9: 88,394,382 N617D possibly damaging Het
Spire2 T C 8: 123,356,727 V150A probably damaging Het
Sptbn1 C A 11: 30,114,787 R1904M probably damaging Het
Swap70 A G 7: 110,281,303 E575G possibly damaging Het
Tbxas1 A T 6: 38,919,153 M1L possibly damaging Het
Tenm3 A T 8: 48,256,837 V1688D probably damaging Het
Tgfbr3 A T 5: 107,149,914 S207T probably damaging Het
Timm44 A G 8: 4,267,282 F248L probably damaging Het
Tmem161a T C 8: 70,181,199 L170P probably damaging Het
Tmem63a A T 1: 180,960,470 Y263F possibly damaging Het
Tnfsf9 C A 17: 57,105,513 L28I probably benign Het
Tph2 T A 10: 115,174,106 N183I probably benign Het
Ttyh1 T C 7: 4,122,529 I60T probably damaging Het
Ubn1 T G 16: 5,064,547 S48A probably damaging Het
Ubr5 T C 15: 37,989,598 N2019S probably benign Het
Wbp2 T C 11: 116,086,910 N6D probably benign Het
Wdr59 T A 8: 111,459,040 E810V possibly damaging Het
Wiz T C 17: 32,360,421 D220G probably damaging Het
Yipf7 A G 5: 69,517,070 L244P probably damaging Het
Zdhhc17 T C 10: 110,955,111 T366A possibly damaging Het
Zfp169 A T 13: 48,490,996 probably benign Het
Zfp707 C T 15: 75,969,723 probably benign Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Fryl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Fryl APN 5 73148108 missense possibly damaging 0.92
IGL01518:Fryl APN 5 73086962 missense possibly damaging 0.76
IGL01545:Fryl APN 5 73054597 missense probably damaging 1.00
IGL01646:Fryl APN 5 73022501 critical splice donor site probably null
IGL01938:Fryl APN 5 73122364 missense probably damaging 0.98
IGL01962:Fryl APN 5 73032791 missense possibly damaging 0.62
IGL02064:Fryl APN 5 73124769 unclassified probably benign
IGL02148:Fryl APN 5 73075959 missense probably benign 0.35
IGL02418:Fryl APN 5 73110176 splice site probably benign
IGL02431:Fryl APN 5 73098308 missense probably benign 0.02
IGL02513:Fryl APN 5 73065293 missense probably damaging 1.00
IGL02557:Fryl APN 5 73098393 missense probably damaging 1.00
IGL02625:Fryl APN 5 73069877 intron probably benign
IGL02642:Fryl APN 5 73095466 missense probably benign
IGL02657:Fryl APN 5 73054860 missense probably benign 0.01
IGL02706:Fryl APN 5 73093163 missense probably benign 0.45
IGL03022:Fryl APN 5 73059383 missense possibly damaging 0.82
IGL03144:Fryl APN 5 73101455 missense probably null 0.22
IGL03155:Fryl APN 5 73076695 missense probably benign
IGL03183:Fryl APN 5 73076695 missense probably benign
IGL03275:Fryl APN 5 73148033 missense possibly damaging 0.47
IGL03310:Fryl APN 5 73136316 splice site probably benign
IGL03341:Fryl APN 5 73076695 missense probably benign
IGL03343:Fryl APN 5 73076695 missense probably benign
IGL03350:Fryl APN 5 73133306 missense probably damaging 0.99
IGL03357:Fryl APN 5 73054059 missense probably damaging 1.00
IGL03374:Fryl APN 5 73110281 splice site probably benign
IGL03375:Fryl APN 5 73088449 missense possibly damaging 0.91
bedeviled UTSW 5 73059500 missense probably damaging 1.00
Besotted UTSW 5 73072912 missense probably damaging 1.00
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0308:Fryl UTSW 5 73041604 splice site probably benign
R0312:Fryl UTSW 5 73072888 missense probably damaging 1.00
R0415:Fryl UTSW 5 73098414 missense probably damaging 0.99
R0440:Fryl UTSW 5 73086972 missense possibly damaging 0.91
R0446:Fryl UTSW 5 73097417 missense possibly damaging 0.91
R0566:Fryl UTSW 5 73064497 splice site probably benign
R0567:Fryl UTSW 5 73065391 missense possibly damaging 0.50
R0606:Fryl UTSW 5 73124734 missense probably benign 0.15
R0619:Fryl UTSW 5 73068731 missense probably benign 0.22
R0654:Fryl UTSW 5 73083372 missense probably benign 0.17
R0658:Fryl UTSW 5 73065359 missense probably damaging 1.00
R0707:Fryl UTSW 5 73083372 missense probably benign 0.17
R0744:Fryl UTSW 5 73089081 unclassified probably benign
R0745:Fryl UTSW 5 73071126 missense probably damaging 0.96
R0833:Fryl UTSW 5 73089081 unclassified probably benign
R0885:Fryl UTSW 5 73089196 missense probably damaging 0.97
R0894:Fryl UTSW 5 73041332 splice site probably benign
R1076:Fryl UTSW 5 73124673 unclassified probably benign
R1241:Fryl UTSW 5 73064925 splice site probably benign
R1241:Fryl UTSW 5 73110271 missense probably damaging 1.00
R1394:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1395:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1608:Fryl UTSW 5 73074751 nonsense probably null
R1664:Fryl UTSW 5 73059435 missense probably damaging 1.00
R1745:Fryl UTSW 5 73032861 splice site probably benign
R1937:Fryl UTSW 5 73133367 missense probably damaging 1.00
R1969:Fryl UTSW 5 73098266 missense probably benign 0.18
R1993:Fryl UTSW 5 73108493 missense probably damaging 1.00
R1994:Fryl UTSW 5 73108493 missense probably damaging 1.00
R2029:Fryl UTSW 5 73022122 nonsense probably null
R2036:Fryl UTSW 5 73022544 missense probably benign
R2036:Fryl UTSW 5 73107962 critical splice donor site probably null
R2088:Fryl UTSW 5 73065461 missense probably benign 0.02
R2105:Fryl UTSW 5 73122299 missense probably benign
R2106:Fryl UTSW 5 73098331 missense probably damaging 1.00
R2186:Fryl UTSW 5 73064975 missense probably damaging 1.00
R2239:Fryl UTSW 5 73108547 missense probably damaging 0.99
R2256:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2257:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2280:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2281:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2911:Fryl UTSW 5 73050456 missense probably damaging 0.99
R3019:Fryl UTSW 5 73082850 missense probably benign 0.01
R3416:Fryl UTSW 5 73108074 missense possibly damaging 0.84
R3783:Fryl UTSW 5 73101476 missense probably benign
R3787:Fryl UTSW 5 73101476 missense probably benign
R3837:Fryl UTSW 5 73071265 missense probably benign 0.03
R3969:Fryl UTSW 5 73112423 missense probably damaging 0.97
R4387:Fryl UTSW 5 73086560 missense possibly damaging 0.91
R4502:Fryl UTSW 5 73088397 missense probably damaging 1.00
R4658:Fryl UTSW 5 73081053 missense probably damaging 1.00
R4664:Fryl UTSW 5 73090679 missense possibly damaging 0.80
R4690:Fryl UTSW 5 73100293 missense probably benign
R4700:Fryl UTSW 5 73065538 missense possibly damaging 0.88
R4709:Fryl UTSW 5 73080972 missense probably benign 0.03
R4807:Fryl UTSW 5 73041362 missense probably benign 0.00
R4912:Fryl UTSW 5 73068782 frame shift probably null
R4948:Fryl UTSW 5 73089130 missense probably benign 0.08
R4959:Fryl UTSW 5 73035058 missense probably benign 0.00
R5062:Fryl UTSW 5 73075893 missense possibly damaging 0.89
R5067:Fryl UTSW 5 73057755 missense probably benign 0.13
R5071:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5072:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5073:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5074:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5139:Fryl UTSW 5 73090718 missense probably damaging 1.00
R5172:Fryl UTSW 5 73101673 missense possibly damaging 0.95
R5187:Fryl UTSW 5 73086600 missense possibly damaging 0.95
R5272:Fryl UTSW 5 73065136 nonsense probably null
R5275:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5295:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5344:Fryl UTSW 5 73104774 missense probably damaging 1.00
R5355:Fryl UTSW 5 73073904 missense probably damaging 1.00
R5716:Fryl UTSW 5 73100465 missense probably benign
R5778:Fryl UTSW 5 73072778 missense probably damaging 1.00
R5810:Fryl UTSW 5 73090755 missense probably benign 0.06
R5934:Fryl UTSW 5 73090717 missense probably damaging 1.00
R5948:Fryl UTSW 5 73097372 critical splice donor site probably null
R6005:Fryl UTSW 5 73083295 missense probably damaging 1.00
R6026:Fryl UTSW 5 73099997 missense probably benign 0.04
R6045:Fryl UTSW 5 73118551 missense probably damaging 0.99
R6185:Fryl UTSW 5 73112788 missense probably benign 0.43
R6247:Fryl UTSW 5 73065481 missense probably damaging 0.98
R6294:Fryl UTSW 5 73191759 intron probably benign
R6310:Fryl UTSW 5 73191761 intron probably benign
R6429:Fryl UTSW 5 73090751 missense possibly damaging 0.84
R6568:Fryl UTSW 5 73059516 missense probably damaging 1.00
R6636:Fryl UTSW 5 73133312 missense probably benign 0.01
R6664:Fryl UTSW 5 73132481 missense probably damaging 1.00
R6732:Fryl UTSW 5 73054781 missense probably damaging 1.00
R6750:Fryl UTSW 5 73022232 missense probably damaging 1.00
R6805:Fryl UTSW 5 73065094 missense probably benign 0.03
R6855:Fryl UTSW 5 73059500 missense probably damaging 1.00
R6858:Fryl UTSW 5 73065032 missense probably damaging 1.00
R6868:Fryl UTSW 5 73068803 missense probably damaging 1.00
R6898:Fryl UTSW 5 73022142 missense probably damaging 0.96
R6908:Fryl UTSW 5 73022211 missense probably damaging 1.00
R6958:Fryl UTSW 5 73073929 missense possibly damaging 0.89
R6980:Fryl UTSW 5 73050430 missense probably benign 0.06
R7036:Fryl UTSW 5 73055608 missense probably benign 0.03
R7065:Fryl UTSW 5 73090756 missense probably damaging 0.96
R7097:Fryl UTSW 5 73073908 missense probably benign 0.31
R7171:Fryl UTSW 5 73122310 missense probably damaging 0.97
R7191:Fryl UTSW 5 73072912 missense probably damaging 1.00
R7207:Fryl UTSW 5 73065095 missense probably benign
R7236:Fryl UTSW 5 73108478 missense possibly damaging 0.66
R7334:Fryl UTSW 5 73047496 intron probably null
R7425:Fryl UTSW 5 73104748 missense probably damaging 1.00
R7452:Fryl UTSW 5 73023988 missense probably damaging 1.00
R7479:Fryl UTSW 5 73097561 missense possibly damaging 0.71
R7535:Fryl UTSW 5 73098196 missense probably benign 0.15
R7538:Fryl UTSW 5 73022676 missense probably benign 0.09
R7544:Fryl UTSW 5 73081039 missense probably benign
R7548:Fryl UTSW 5 73191762 missense unknown
R7565:Fryl UTSW 5 73033720 missense probably benign 0.18
R7572:Fryl UTSW 5 73088396 missense possibly damaging 0.91
R7582:Fryl UTSW 5 73022500 critical splice donor site probably null
R7630:Fryl UTSW 5 73110245 missense possibly damaging 0.62
Z1088:Fryl UTSW 5 73090709 missense probably damaging 0.99
Z1088:Fryl UTSW 5 73090738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGTCATCTCTTGGGTAGACAC -3'
(R):5'- GTTAAGTCTAGTTGGTGACCGC -3'

Sequencing Primer
(F):5'- CATCTCTTGGGTAGACACTGAGG -3'
(R):5'- CCGCAGAGGTGACCGGC -3'
Posted On2018-10-18