Mutagenetix > Incidental Mutations

Incidental Mutation 'R6823:Fryl'

537720

Institutional Source

Beutler Lab

Gene Symbol

Fryl

Ensembl Gene

ENSMUSG00000070733

Gene Name

FRY like transcription coactivator

Synonyms

2510002A14Rik, 2310004H21Rik, 9030227G01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.870) question?

Stock #

R6823 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73019987-73256619 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 73065217 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 2007 (I2007K)

Ref Sequence

ENSEMBL: ENSMUSP00000098687 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127]

Predicted Effect

probably damaging
Transcript: ENSMUST00000094700
AA Change: I2007K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: I2007K

Domain	Start	End	E-Value	Type
Pfam:MOR2-PAG1_N	117	649	5.7e-176	PFAM
low complexity region	873	884	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	896	1141	1.3e-5	PFAM
Pfam:MOR2-PAG1_mid	1145	1331	2e-19	PFAM
Pfam:MOR2-PAG1_mid	1351	1450	1.2e-5	PFAM
low complexity region	1476	1487	N/A	INTRINSIC
low complexity region	1530	1548	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	1590	1660	1.1e-5	PFAM
Pfam:MOR2-PAG1_mid	1725	1866	3.2e-15	PFAM
low complexity region	1973	1984	N/A	INTRINSIC
Pfam:MOR2-PAG1_C	2002	2255	9.9e-78	PFAM
low complexity region	2329	2341	N/A	INTRINSIC
low complexity region	2473	2482	N/A	INTRINSIC
low complexity region	2485	2500	N/A	INTRINSIC
low complexity region	2523	2534	N/A	INTRINSIC
coiled coil region	2625	2649	N/A	INTRINSIC
low complexity region	2827	2841	N/A	INTRINSIC
coiled coil region	2854	2893	N/A	INTRINSIC
coiled coil region	2963	2989	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000101127
AA Change: I2007K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: I2007K

Domain	Start	End	E-Value	Type
Pfam:MOR2-PAG1_N	116	649	3e-172	PFAM
low complexity region	873	884	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	898	1115	7.8e-6	PFAM
Pfam:MOR2-PAG1_mid	1147	1331	9.5e-19	PFAM
Pfam:MOR2-PAG1_mid	1351	1503	1.1e-5	PFAM
low complexity region	1530	1548	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	1589	1664	6e-6	PFAM
Pfam:MOR2-PAG1_mid	1725	1866	1.6e-14	PFAM
low complexity region	1973	1984	N/A	INTRINSIC
Pfam:MOR2-PAG1_C	1998	2260	4.4e-76	PFAM
low complexity region	2329	2341	N/A	INTRINSIC
low complexity region	2473	2482	N/A	INTRINSIC
low complexity region	2485	2500	N/A	INTRINSIC
low complexity region	2523	2534	N/A	INTRINSIC
coiled coil region	2625	2649	N/A	INTRINSIC
low complexity region	2827	2841	N/A	INTRINSIC
coiled coil region	2854	2893	N/A	INTRINSIC
coiled coil region	2963	2989	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201277

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

98% (81/83)

MGI Phenotype

PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	T	G	15: 64,754,886		probably null	Het
Adgrv1	A	G	13: 81,557,081	F1537L	probably damaging	Het
Aggf1	T	C	13: 95,364,723	S384G	probably benign	Het
Anxa8	A	T	14: 34,094,765	D204V	possibly damaging	Het
Asap3	A	T	4: 136,227,572	E71V	possibly damaging	Het
BC024139	T	C	15: 76,119,746	*773W	probably null	Het
Bckdhb	T	C	9: 83,953,761	V106A	possibly damaging	Het
Cep250	A	G	2: 155,981,459	D1010G	probably benign	Het
Chrd	T	A	16: 20,734,736	L243Q	probably damaging	Het
Cib2	G	T	9: 54,549,891	L30I	possibly damaging	Het
Cpsf7	T	A	19: 10,532,884	L113*	probably null	Het
Cubn	T	A	2: 13,445,029	I895L	probably benign	Het
Cyp24a1	C	A	2: 170,487,979	R351I	probably benign	Het
Cyp2a12	A	T	7: 27,034,156	D320V	possibly damaging	Het
Dact1	C	G	12: 71,317,939	P498R	probably benign	Het
Diaph1	T	A	18: 37,876,383		probably null	Het
Dnah7a	A	T	1: 53,456,704	I3198N	probably benign	Het
Dopey2	A	T	16: 93,755,485	I271F	possibly damaging	Het
Erich3	C	A	3: 154,727,437	F349L	probably damaging	Het
Fam187b	G	C	7: 30,989,290	V358L	probably benign	Het
Fat4	T	A	3: 38,983,939	H3913Q	probably benign	Het
Fbxw7	G	C	3: 84,958,627	E118D	probably benign	Het
Fgf1	A	G	18: 38,847,108	I71T	probably damaging	Het
Galnt2	C	G	8: 124,324,011	P130A	probably benign	Het
H1fx	G	A	6: 87,981,302	R19C	probably damaging	Het
Hmga2	A	C	10: 120,476,024	S14A	possibly damaging	Het
Hoxb4	C	T	11: 96,318,654		probably benign	Het
Hr	A	T	14: 70,565,374	I756F	probably damaging	Het
Hrasls5	A	T	19: 7,639,496		probably benign	Het
Hspa1b	A	T	17: 34,958,185	S275T	probably benign	Het
Ikbkap	A	G	4: 56,787,939	Y331H	probably damaging	Het
Kcnh1	T	C	1: 192,505,289	*99R	probably null	Het
Kit	C	A	5: 75,652,649	L864I	probably benign	Het
Klk14	A	T	7: 43,694,456	K196*	probably null	Het
Lmod1	A	G	1: 135,325,167	N53S	probably damaging	Het
Myh13	T	C	11: 67,356,158	M1235T	probably benign	Het
Neurl3	T	A	1: 36,268,704	K175*	probably null	Het
Nlgn2	T	A	11: 69,825,924	K597M	probably damaging	Het
Npdc1	T	C	2: 25,409,109	M306T	probably damaging	Het
Obscn	C	T	11: 59,067,943		probably null	Het
Olfr404-ps1	T	C	11: 74,239,696	L44P	probably damaging	Het
Olfr553	G	A	7: 102,614,486	L168F	probably damaging	Het
Olfr913	T	C	9: 38,594,905	I228T	possibly damaging	Het
Pbrm1	A	T	14: 31,084,790	Y1042F	probably damaging	Het
Pclo	T	A	5: 14,677,907		probably benign	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Phf12	C	T	11: 78,022,511	Q430*	probably null	Het
Pld3	C	T	7: 27,535,897	R302H	probably damaging	Het
Plekha5	T	C	6: 140,525,858	S112P	probably benign	Het
Pmfbp1	T	A	8: 109,530,307	S548T	possibly damaging	Het
Ppa1	A	T	10: 61,667,603	I220F	probably damaging	Het
Ppp2r3d	A	G	9: 124,439,078		probably benign	Het
Psmg2	A	T	18: 67,648,857	E164D	possibly damaging	Het
Rarb	T	C	14: 16,443,824	R155G	probably damaging	Het
Rnf215	T	C	11: 4,136,609	L162S	probably damaging	Het
Rsf1	GGCG	GGCGACGGCCGCG	7: 97,579,906		probably benign	Het
Rtkn2	G	A	10: 68,026,632	V330M	probably damaging	Het
Slc16a4	A	T	3: 107,311,498	I472F	probably benign	Het
Snx14	T	C	9: 88,394,382	N617D	possibly damaging	Het
Spire2	T	C	8: 123,356,727	V150A	probably damaging	Het
Sptbn1	C	A	11: 30,114,787	R1904M	probably damaging	Het
Swap70	A	G	7: 110,281,303	E575G	possibly damaging	Het
Tbxas1	A	T	6: 38,919,153	M1L	possibly damaging	Het
Tenm3	A	T	8: 48,256,837	V1688D	probably damaging	Het
Tgfbr3	A	T	5: 107,149,914	S207T	probably damaging	Het
Timm44	A	G	8: 4,267,282	F248L	probably damaging	Het
Tmem161a	T	C	8: 70,181,199	L170P	probably damaging	Het
Tmem63a	A	T	1: 180,960,470	Y263F	possibly damaging	Het
Tnfsf9	C	A	17: 57,105,513	L28I	probably benign	Het
Tph2	T	A	10: 115,174,106	N183I	probably benign	Het
Ttyh1	T	C	7: 4,122,529	I60T	probably damaging	Het
Ubn1	T	G	16: 5,064,547	S48A	probably damaging	Het
Ubr5	T	C	15: 37,989,598	N2019S	probably benign	Het
Wbp2	T	C	11: 116,086,910	N6D	probably benign	Het
Wdr59	T	A	8: 111,459,040	E810V	possibly damaging	Het
Wiz	T	C	17: 32,360,421	D220G	probably damaging	Het
Yipf7	A	G	5: 69,517,070	L244P	probably damaging	Het
Zdhhc17	T	C	10: 110,955,111	T366A	possibly damaging	Het
Zfp169	A	T	13: 48,490,996		probably benign	Het
Zfp707	C	T	15: 75,969,723		probably benign	Het
Zfp788	A	G	7: 41,649,560	H540R	probably damaging	Het

Other mutations in Fryl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00819:Fryl	APN	5	73148108	missense	possibly damaging	0.92
IGL01518:Fryl	APN	5	73086962	missense	possibly damaging	0.76
IGL01545:Fryl	APN	5	73054597	missense	probably damaging	1.00
IGL01646:Fryl	APN	5	73022501	critical splice donor site	probably null
IGL01938:Fryl	APN	5	73122364	missense	probably damaging	0.98
IGL01962:Fryl	APN	5	73032791	missense	possibly damaging	0.62
IGL02064:Fryl	APN	5	73124769	unclassified	probably benign
IGL02148:Fryl	APN	5	73075959	missense	probably benign	0.35
IGL02418:Fryl	APN	5	73110176	splice site	probably benign
IGL02431:Fryl	APN	5	73098308	missense	probably benign	0.02
IGL02513:Fryl	APN	5	73065293	missense	probably damaging	1.00
IGL02557:Fryl	APN	5	73098393	missense	probably damaging	1.00
IGL02625:Fryl	APN	5	73069877	intron	probably benign
IGL02642:Fryl	APN	5	73095466	missense	probably benign
IGL02657:Fryl	APN	5	73054860	missense	probably benign	0.01
IGL02706:Fryl	APN	5	73093163	missense	probably benign	0.45
IGL03022:Fryl	APN	5	73059383	missense	possibly damaging	0.82
IGL03144:Fryl	APN	5	73101455	missense	probably null	0.22
IGL03155:Fryl	APN	5	73076695	missense	probably benign
IGL03183:Fryl	APN	5	73076695	missense	probably benign
IGL03275:Fryl	APN	5	73148033	missense	possibly damaging	0.47
IGL03310:Fryl	APN	5	73136316	splice site	probably benign
IGL03341:Fryl	APN	5	73076695	missense	probably benign
IGL03343:Fryl	APN	5	73076695	missense	probably benign
IGL03350:Fryl	APN	5	73133306	missense	probably damaging	0.99
IGL03357:Fryl	APN	5	73054059	missense	probably damaging	1.00
IGL03374:Fryl	APN	5	73110281	splice site	probably benign
IGL03375:Fryl	APN	5	73088449	missense	possibly damaging	0.91
bedeviled	UTSW	5	73059500	missense	probably damaging	1.00
Besotted	UTSW	5	73072912	missense	probably damaging	1.00
R0062:Fryl	UTSW	5	73022278	missense	probably benign	0.02
R0062:Fryl	UTSW	5	73022278	missense	probably benign	0.02
R0308:Fryl	UTSW	5	73041604	splice site	probably benign
R0312:Fryl	UTSW	5	73072888	missense	probably damaging	1.00
R0415:Fryl	UTSW	5	73098414	missense	probably damaging	0.99
R0440:Fryl	UTSW	5	73086972	missense	possibly damaging	0.91
R0446:Fryl	UTSW	5	73097417	missense	possibly damaging	0.91
R0566:Fryl	UTSW	5	73064497	splice site	probably benign
R0567:Fryl	UTSW	5	73065391	missense	possibly damaging	0.50
R0606:Fryl	UTSW	5	73124734	missense	probably benign	0.15
R0619:Fryl	UTSW	5	73068731	missense	probably benign	0.22
R0654:Fryl	UTSW	5	73083372	missense	probably benign	0.17
R0658:Fryl	UTSW	5	73065359	missense	probably damaging	1.00
R0707:Fryl	UTSW	5	73083372	missense	probably benign	0.17
R0744:Fryl	UTSW	5	73089081	unclassified	probably benign
R0745:Fryl	UTSW	5	73071126	missense	probably damaging	0.96
R0833:Fryl	UTSW	5	73089081	unclassified	probably benign
R0885:Fryl	UTSW	5	73089196	missense	probably damaging	0.97
R0894:Fryl	UTSW	5	73041332	splice site	probably benign
R1076:Fryl	UTSW	5	73124673	unclassified	probably benign
R1241:Fryl	UTSW	5	73064925	splice site	probably benign
R1241:Fryl	UTSW	5	73110271	missense	probably damaging	1.00
R1394:Fryl	UTSW	5	73072912	missense	probably damaging	1.00
R1395:Fryl	UTSW	5	73072912	missense	probably damaging	1.00
R1608:Fryl	UTSW	5	73074751	nonsense	probably null
R1664:Fryl	UTSW	5	73059435	missense	probably damaging	1.00
R1745:Fryl	UTSW	5	73032861	splice site	probably benign
R1937:Fryl	UTSW	5	73133367	missense	probably damaging	1.00
R1969:Fryl	UTSW	5	73098266	missense	probably benign	0.18
R1993:Fryl	UTSW	5	73108493	missense	probably damaging	1.00
R1994:Fryl	UTSW	5	73108493	missense	probably damaging	1.00
R2029:Fryl	UTSW	5	73022122	nonsense	probably null
R2036:Fryl	UTSW	5	73022544	missense	probably benign
R2036:Fryl	UTSW	5	73107962	critical splice donor site	probably null
R2088:Fryl	UTSW	5	73065461	missense	probably benign	0.02
R2105:Fryl	UTSW	5	73122299	missense	probably benign
R2106:Fryl	UTSW	5	73098331	missense	probably damaging	1.00
R2186:Fryl	UTSW	5	73064975	missense	probably damaging	1.00
R2239:Fryl	UTSW	5	73108547	missense	probably damaging	0.99
R2256:Fryl	UTSW	5	73072844	missense	possibly damaging	0.47
R2257:Fryl	UTSW	5	73072844	missense	possibly damaging	0.47
R2280:Fryl	UTSW	5	73041364	missense	possibly damaging	0.47
R2281:Fryl	UTSW	5	73041364	missense	possibly damaging	0.47
R2911:Fryl	UTSW	5	73050456	missense	probably damaging	0.99
R3019:Fryl	UTSW	5	73082850	missense	probably benign	0.01
R3416:Fryl	UTSW	5	73108074	missense	possibly damaging	0.84
R3783:Fryl	UTSW	5	73101476	missense	probably benign
R3787:Fryl	UTSW	5	73101476	missense	probably benign
R3837:Fryl	UTSW	5	73071265	missense	probably benign	0.03
R3969:Fryl	UTSW	5	73112423	missense	probably damaging	0.97
R4387:Fryl	UTSW	5	73086560	missense	possibly damaging	0.91
R4502:Fryl	UTSW	5	73088397	missense	probably damaging	1.00
R4658:Fryl	UTSW	5	73081053	missense	probably damaging	1.00
R4664:Fryl	UTSW	5	73090679	missense	possibly damaging	0.80
R4690:Fryl	UTSW	5	73100293	missense	probably benign
R4700:Fryl	UTSW	5	73065538	missense	possibly damaging	0.88
R4709:Fryl	UTSW	5	73080972	missense	probably benign	0.03
R4807:Fryl	UTSW	5	73041362	missense	probably benign	0.00
R4912:Fryl	UTSW	5	73068782	frame shift	probably null
R4948:Fryl	UTSW	5	73089130	missense	probably benign	0.08
R4959:Fryl	UTSW	5	73035058	missense	probably benign	0.00
R5062:Fryl	UTSW	5	73075893	missense	possibly damaging	0.89
R5067:Fryl	UTSW	5	73057755	missense	probably benign	0.13
R5071:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5072:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5073:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5074:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5139:Fryl	UTSW	5	73090718	missense	probably damaging	1.00
R5172:Fryl	UTSW	5	73101673	missense	possibly damaging	0.95
R5187:Fryl	UTSW	5	73086600	missense	possibly damaging	0.95
R5272:Fryl	UTSW	5	73065136	nonsense	probably null
R5275:Fryl	UTSW	5	73112791	missense	probably damaging	1.00
R5295:Fryl	UTSW	5	73112791	missense	probably damaging	1.00
R5344:Fryl	UTSW	5	73104774	missense	probably damaging	1.00
R5355:Fryl	UTSW	5	73073904	missense	probably damaging	1.00
R5716:Fryl	UTSW	5	73100465	missense	probably benign
R5778:Fryl	UTSW	5	73072778	missense	probably damaging	1.00
R5810:Fryl	UTSW	5	73090755	missense	probably benign	0.06
R5934:Fryl	UTSW	5	73090717	missense	probably damaging	1.00
R5948:Fryl	UTSW	5	73097372	critical splice donor site	probably null
R6005:Fryl	UTSW	5	73083295	missense	probably damaging	1.00
R6026:Fryl	UTSW	5	73099997	missense	probably benign	0.04
R6045:Fryl	UTSW	5	73118551	missense	probably damaging	0.99
R6185:Fryl	UTSW	5	73112788	missense	probably benign	0.43
R6247:Fryl	UTSW	5	73065481	missense	probably damaging	0.98
R6294:Fryl	UTSW	5	73191759	intron	probably benign
R6310:Fryl	UTSW	5	73191761	intron	probably benign
R6429:Fryl	UTSW	5	73090751	missense	possibly damaging	0.84
R6568:Fryl	UTSW	5	73059516	missense	probably damaging	1.00
R6636:Fryl	UTSW	5	73133312	missense	probably benign	0.01
R6664:Fryl	UTSW	5	73132481	missense	probably damaging	1.00
R6732:Fryl	UTSW	5	73054781	missense	probably damaging	1.00
R6750:Fryl	UTSW	5	73022232	missense	probably damaging	1.00
R6805:Fryl	UTSW	5	73065094	missense	probably benign	0.03
R6855:Fryl	UTSW	5	73059500	missense	probably damaging	1.00
R6858:Fryl	UTSW	5	73065032	missense	probably damaging	1.00
R6868:Fryl	UTSW	5	73068803	missense	probably damaging	1.00
R6898:Fryl	UTSW	5	73022142	missense	probably damaging	0.96
R6908:Fryl	UTSW	5	73022211	missense	probably damaging	1.00
R6958:Fryl	UTSW	5	73073929	missense	possibly damaging	0.89
R6980:Fryl	UTSW	5	73050430	missense	probably benign	0.06
R7036:Fryl	UTSW	5	73055608	missense	probably benign	0.03
R7065:Fryl	UTSW	5	73090756	missense	probably damaging	0.96
R7097:Fryl	UTSW	5	73073908	missense	probably benign	0.31
R7171:Fryl	UTSW	5	73122310	missense	probably damaging	0.97
R7191:Fryl	UTSW	5	73072912	missense	probably damaging	1.00
R7207:Fryl	UTSW	5	73065095	missense	probably benign
R7236:Fryl	UTSW	5	73108478	missense	possibly damaging	0.66
R7334:Fryl	UTSW	5	73047496	intron	probably null
R7425:Fryl	UTSW	5	73104748	missense	probably damaging	1.00
R7452:Fryl	UTSW	5	73023988	missense	probably damaging	1.00
R7479:Fryl	UTSW	5	73097561	missense	possibly damaging	0.71
R7535:Fryl	UTSW	5	73098196	missense	probably benign	0.15
R7538:Fryl	UTSW	5	73022676	missense	probably benign	0.09
R7544:Fryl	UTSW	5	73081039	missense	probably benign
R7548:Fryl	UTSW	5	73191762	missense	unknown
R7565:Fryl	UTSW	5	73033720	missense	probably benign	0.18
R7572:Fryl	UTSW	5	73088396	missense	possibly damaging	0.91
R7582:Fryl	UTSW	5	73022500	critical splice donor site	probably null
R7630:Fryl	UTSW	5	73110245	missense	possibly damaging	0.62
Z1088:Fryl	UTSW	5	73090709	missense	probably damaging	0.99
Z1088:Fryl	UTSW	5	73090738	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGGTCATCTCTTGGGTAGACAC -3'
(R):5'- GTTAAGTCTAGTTGGTGACCGC -3'

Sequencing Primer
(F):5'- CATCTCTTGGGTAGACACTGAGG -3'
(R):5'- CCGCAGAGGTGACCGGC -3'

Posted On

2018-10-18