Incidental Mutation 'R6823:Tgfbr3'
ID537722
Institutional Source Beutler Lab
Gene Symbol Tgfbr3
Ensembl Gene ENSMUSG00000029287
Gene Nametransforming growth factor, beta receptor III
Synonymsbetaglycan, TBRIII, 1110036H20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6823 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location107106570-107289629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107149914 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 207 (S207T)
Ref Sequence ENSEMBL: ENSMUSP00000031224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031224]
Predicted Effect probably damaging
Transcript: ENSMUST00000031224
AA Change: S207T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031224
Gene: ENSMUSG00000029287
AA Change: S207T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
internal_repeat_1 64 193 2.48e-5 PROSPERO
internal_repeat_1 232 361 2.48e-5 PROSPERO
low complexity region 419 430 N/A INTRINSIC
ZP 454 731 8.12e-65 SMART
transmembrane domain 786 808 N/A INTRINSIC
low complexity region 835 849 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes the transforming growth factor (TGF)-beta type III receptor. The encoded receptor is a membrane proteoglycan that often functions as a co-receptor with other TGF-beta receptor superfamily members. Ectodomain shedding produces soluble TGFBR3, which may inhibit TGFB signaling. Decreased expression of this receptor has been observed in various cancers. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die as embryos. The very few individuals that survive are poorly fertile with abnormalities of the spleen, liver, heart, and skeletal system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,754,886 probably null Het
Adgrv1 A G 13: 81,557,081 F1537L probably damaging Het
Aggf1 T C 13: 95,364,723 S384G probably benign Het
Anxa8 A T 14: 34,094,765 D204V possibly damaging Het
Asap3 A T 4: 136,227,572 E71V possibly damaging Het
BC024139 T C 15: 76,119,746 *773W probably null Het
Bckdhb T C 9: 83,953,761 V106A possibly damaging Het
Cep250 A G 2: 155,981,459 D1010G probably benign Het
Chrd T A 16: 20,734,736 L243Q probably damaging Het
Cib2 G T 9: 54,549,891 L30I possibly damaging Het
Cpsf7 T A 19: 10,532,884 L113* probably null Het
Cubn T A 2: 13,445,029 I895L probably benign Het
Cyp24a1 C A 2: 170,487,979 R351I probably benign Het
Cyp2a12 A T 7: 27,034,156 D320V possibly damaging Het
Dact1 C G 12: 71,317,939 P498R probably benign Het
Diaph1 T A 18: 37,876,383 probably null Het
Dnah7a A T 1: 53,456,704 I3198N probably benign Het
Dopey2 A T 16: 93,755,485 I271F possibly damaging Het
Erich3 C A 3: 154,727,437 F349L probably damaging Het
Fam187b G C 7: 30,989,290 V358L probably benign Het
Fat4 T A 3: 38,983,939 H3913Q probably benign Het
Fbxw7 G C 3: 84,958,627 E118D probably benign Het
Fgf1 A G 18: 38,847,108 I71T probably damaging Het
Fryl A T 5: 73,065,217 I2007K probably damaging Het
Galnt2 C G 8: 124,324,011 P130A probably benign Het
H1fx G A 6: 87,981,302 R19C probably damaging Het
Hmga2 A C 10: 120,476,024 S14A possibly damaging Het
Hoxb4 C T 11: 96,318,654 probably benign Het
Hr A T 14: 70,565,374 I756F probably damaging Het
Hrasls5 A T 19: 7,639,496 probably benign Het
Hspa1b A T 17: 34,958,185 S275T probably benign Het
Ikbkap A G 4: 56,787,939 Y331H probably damaging Het
Kcnh1 T C 1: 192,505,289 *99R probably null Het
Kit C A 5: 75,652,649 L864I probably benign Het
Klk14 A T 7: 43,694,456 K196* probably null Het
Lmod1 A G 1: 135,325,167 N53S probably damaging Het
Myh13 T C 11: 67,356,158 M1235T probably benign Het
Neurl3 T A 1: 36,268,704 K175* probably null Het
Nlgn2 T A 11: 69,825,924 K597M probably damaging Het
Npdc1 T C 2: 25,409,109 M306T probably damaging Het
Obscn C T 11: 59,067,943 probably null Het
Olfr404-ps1 T C 11: 74,239,696 L44P probably damaging Het
Olfr553 G A 7: 102,614,486 L168F probably damaging Het
Olfr913 T C 9: 38,594,905 I228T possibly damaging Het
Pbrm1 A T 14: 31,084,790 Y1042F probably damaging Het
Pclo T A 5: 14,677,907 probably benign Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Phf12 C T 11: 78,022,511 Q430* probably null Het
Pld3 C T 7: 27,535,897 R302H probably damaging Het
Plekha5 T C 6: 140,525,858 S112P probably benign Het
Pmfbp1 T A 8: 109,530,307 S548T possibly damaging Het
Ppa1 A T 10: 61,667,603 I220F probably damaging Het
Ppp2r3d A G 9: 124,439,078 probably benign Het
Psmg2 A T 18: 67,648,857 E164D possibly damaging Het
Rarb T C 14: 16,443,824 R155G probably damaging Het
Rnf215 T C 11: 4,136,609 L162S probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Rtkn2 G A 10: 68,026,632 V330M probably damaging Het
Slc16a4 A T 3: 107,311,498 I472F probably benign Het
Snx14 T C 9: 88,394,382 N617D possibly damaging Het
Spire2 T C 8: 123,356,727 V150A probably damaging Het
Sptbn1 C A 11: 30,114,787 R1904M probably damaging Het
Swap70 A G 7: 110,281,303 E575G possibly damaging Het
Tbxas1 A T 6: 38,919,153 M1L possibly damaging Het
Tenm3 A T 8: 48,256,837 V1688D probably damaging Het
Timm44 A G 8: 4,267,282 F248L probably damaging Het
Tmem161a T C 8: 70,181,199 L170P probably damaging Het
Tmem63a A T 1: 180,960,470 Y263F possibly damaging Het
Tnfsf9 C A 17: 57,105,513 L28I probably benign Het
Tph2 T A 10: 115,174,106 N183I probably benign Het
Ttyh1 T C 7: 4,122,529 I60T probably damaging Het
Ubn1 T G 16: 5,064,547 S48A probably damaging Het
Ubr5 T C 15: 37,989,598 N2019S probably benign Het
Wbp2 T C 11: 116,086,910 N6D probably benign Het
Wdr59 T A 8: 111,459,040 E810V possibly damaging Het
Wiz T C 17: 32,360,421 D220G probably damaging Het
Yipf7 A G 5: 69,517,070 L244P probably damaging Het
Zdhhc17 T C 10: 110,955,111 T366A possibly damaging Het
Zfp169 A T 13: 48,490,996 probably benign Het
Zfp707 C T 15: 75,969,723 probably benign Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Tgfbr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Tgfbr3 APN 5 107142501 missense probably benign 0.00
IGL01135:Tgfbr3 APN 5 107215028 missense probably damaging 1.00
IGL01375:Tgfbr3 APN 5 107136971 missense probably benign
IGL01457:Tgfbr3 APN 5 107149898 missense probably damaging 1.00
IGL01599:Tgfbr3 APN 5 107118451 missense probably damaging 0.98
IGL01646:Tgfbr3 APN 5 107121413 splice site probably benign
IGL01945:Tgfbr3 APN 5 107121358 critical splice donor site probably null
IGL03039:Tgfbr3 APN 5 107177799 splice site probably benign
IGL03202:Tgfbr3 APN 5 107109764 splice site probably benign
IGL03378:Tgfbr3 APN 5 107109702 missense probably damaging 1.00
R0131:Tgfbr3 UTSW 5 107132816 missense probably benign 0.00
R0452:Tgfbr3 UTSW 5 107140423 missense probably benign 0.00
R0665:Tgfbr3 UTSW 5 107177850 missense probably benign 0.11
R0667:Tgfbr3 UTSW 5 107177850 missense probably benign 0.11
R0751:Tgfbr3 UTSW 5 107139883 missense probably damaging 1.00
R1373:Tgfbr3 UTSW 5 107214943 missense probably benign 0.01
R1777:Tgfbr3 UTSW 5 107136930 missense probably benign 0.31
R1887:Tgfbr3 UTSW 5 107137008 missense probably damaging 1.00
R3019:Tgfbr3 UTSW 5 107137546 missense possibly damaging 0.70
R3552:Tgfbr3 UTSW 5 107139839 missense probably damaging 0.99
R3617:Tgfbr3 UTSW 5 107140619 missense possibly damaging 0.65
R3901:Tgfbr3 UTSW 5 107214887 splice site probably benign
R4830:Tgfbr3 UTSW 5 107109719 missense probably damaging 1.00
R4939:Tgfbr3 UTSW 5 107130469 missense probably benign
R5020:Tgfbr3 UTSW 5 107214970 missense probably damaging 1.00
R5044:Tgfbr3 UTSW 5 107136929 missense possibly damaging 0.88
R5619:Tgfbr3 UTSW 5 107140514 missense probably benign 0.23
R5752:Tgfbr3 UTSW 5 107139807 missense probably benign 0.01
R5768:Tgfbr3 UTSW 5 107149895 missense probably benign
R5799:Tgfbr3 UTSW 5 107109608 utr 3 prime probably benign
R5818:Tgfbr3 UTSW 5 107133003 missense probably benign
R5846:Tgfbr3 UTSW 5 107140655 missense possibly damaging 0.51
R5859:Tgfbr3 UTSW 5 107140515 missense probably benign 0.00
R6049:Tgfbr3 UTSW 5 107118485 missense probably damaging 0.99
R6378:Tgfbr3 UTSW 5 107177813 missense probably benign 0.00
R6696:Tgfbr3 UTSW 5 107136930 missense probably benign 0.02
R6994:Tgfbr3 UTSW 5 107133026 missense probably damaging 1.00
R7454:Tgfbr3 UTSW 5 107215028 missense probably damaging 1.00
R7773:Tgfbr3 UTSW 5 107140502 missense probably benign 0.00
R7978:Tgfbr3 UTSW 5 107139860 missense probably damaging 1.00
R8201:Tgfbr3 UTSW 5 107130565 missense probably benign 0.01
R8296:Tgfbr3 UTSW 5 107139774 missense probably damaging 1.00
X0022:Tgfbr3 UTSW 5 107136926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAGAACAGATCTTTACTTTCATCTC -3'
(R):5'- CCACAGATGAGGACCCTTTG -3'

Sequencing Primer
(F):5'- TTCTCAGGTTATAACACACACATACG -3'
(R):5'- CCTTTGGGCTCGTGGCTTC -3'
Posted On2018-10-18