Incidental Mutation 'R6823:Olfr553'
ID 537732
Institutional Source Beutler Lab
Gene Symbol Olfr553
Ensembl Gene ENSMUSG00000073972
Gene Name olfactory receptor 553
Synonyms MOR25-2, GA_x6K02T2PBJ9-5333671-5332712
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R6823 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 102611281-102618218 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 102614486 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 168 (L168F)
Ref Sequence ENSEMBL: ENSMUSP00000149901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098222] [ENSMUST00000216776]
AlphaFold Q7TRS6
Predicted Effect probably damaging
Transcript: ENSMUST00000098222
AA Change: L168F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095825
Gene: ENSMUSG00000073972
AA Change: L168F

DomainStartEndE-ValueType
Pfam:7tm_4 40 319 1.1e-108 PFAM
Pfam:7TM_GPCR_Srsx 44 158 1.3e-9 PFAM
Pfam:7tm_1 50 302 4.9e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216776
AA Change: L168F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,754,886 probably null Het
Adgrv1 A G 13: 81,557,081 F1537L probably damaging Het
Aggf1 T C 13: 95,364,723 S384G probably benign Het
Anxa8 A T 14: 34,094,765 D204V possibly damaging Het
Asap3 A T 4: 136,227,572 E71V possibly damaging Het
BC024139 T C 15: 76,119,746 *773W probably null Het
Bckdhb T C 9: 83,953,761 V106A possibly damaging Het
Cep250 A G 2: 155,981,459 D1010G probably benign Het
Chrd T A 16: 20,734,736 L243Q probably damaging Het
Cib2 G T 9: 54,549,891 L30I possibly damaging Het
Cpsf7 T A 19: 10,532,884 L113* probably null Het
Cubn T A 2: 13,445,029 I895L probably benign Het
Cyp24a1 C A 2: 170,487,979 R351I probably benign Het
Cyp2a12 A T 7: 27,034,156 D320V possibly damaging Het
Dact1 C G 12: 71,317,939 P498R probably benign Het
Diaph1 T A 18: 37,876,383 probably null Het
Dnah7a A T 1: 53,456,704 I3198N probably benign Het
Dopey2 A T 16: 93,755,485 I271F possibly damaging Het
Erich3 C A 3: 154,727,437 F349L probably damaging Het
Fam187b G C 7: 30,989,290 V358L probably benign Het
Fat4 T A 3: 38,983,939 H3913Q probably benign Het
Fbxw7 G C 3: 84,958,627 E118D probably benign Het
Fgf1 A G 18: 38,847,108 I71T probably damaging Het
Fryl A T 5: 73,065,217 I2007K probably damaging Het
Galnt2 C G 8: 124,324,011 P130A probably benign Het
H1fx G A 6: 87,981,302 R19C probably damaging Het
Hmga2 A C 10: 120,476,024 S14A possibly damaging Het
Hoxb4 C T 11: 96,318,654 probably benign Het
Hr A T 14: 70,565,374 I756F probably damaging Het
Hrasls5 A T 19: 7,639,496 probably benign Het
Hspa1b A T 17: 34,958,185 S275T probably benign Het
Ikbkap A G 4: 56,787,939 Y331H probably damaging Het
Kcnh1 T C 1: 192,505,289 *99R probably null Het
Kit C A 5: 75,652,649 L864I probably benign Het
Klk14 A T 7: 43,694,456 K196* probably null Het
Lmod1 A G 1: 135,325,167 N53S probably damaging Het
Myh13 T C 11: 67,356,158 M1235T probably benign Het
Neurl3 T A 1: 36,268,704 K175* probably null Het
Nlgn2 T A 11: 69,825,924 K597M probably damaging Het
Npdc1 T C 2: 25,409,109 M306T probably damaging Het
Obscn C T 11: 59,067,943 probably null Het
Olfr404-ps1 T C 11: 74,239,696 L44P probably damaging Het
Olfr913 T C 9: 38,594,905 I228T possibly damaging Het
Pbrm1 A T 14: 31,084,790 Y1042F probably damaging Het
Pclo T A 5: 14,677,907 probably benign Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Phf12 C T 11: 78,022,511 Q430* probably null Het
Pld3 C T 7: 27,535,897 R302H probably damaging Het
Plekha5 T C 6: 140,525,858 S112P probably benign Het
Pmfbp1 T A 8: 109,530,307 S548T possibly damaging Het
Ppa1 A T 10: 61,667,603 I220F probably damaging Het
Ppp2r3d A G 9: 124,439,078 probably benign Het
Psmg2 A T 18: 67,648,857 E164D possibly damaging Het
Rarb T C 14: 16,443,824 R155G probably damaging Het
Rnf215 T C 11: 4,136,609 L162S probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Rtkn2 G A 10: 68,026,632 V330M probably damaging Het
Slc16a4 A T 3: 107,311,498 I472F probably benign Het
Snx14 T C 9: 88,394,382 N617D possibly damaging Het
Spire2 T C 8: 123,356,727 V150A probably damaging Het
Sptbn1 C A 11: 30,114,787 R1904M probably damaging Het
Swap70 A G 7: 110,281,303 E575G possibly damaging Het
Tbxas1 A T 6: 38,919,153 M1L possibly damaging Het
Tenm3 A T 8: 48,256,837 V1688D probably damaging Het
Tgfbr3 A T 5: 107,149,914 S207T probably damaging Het
Timm44 A G 8: 4,267,282 F248L probably damaging Het
Tmem161a T C 8: 70,181,199 L170P probably damaging Het
Tmem63a A T 1: 180,960,470 Y263F possibly damaging Het
Tnfsf9 C A 17: 57,105,513 L28I probably benign Het
Tph2 T A 10: 115,174,106 N183I probably benign Het
Ttyh1 T C 7: 4,122,529 I60T probably damaging Het
Ubn1 T G 16: 5,064,547 S48A probably damaging Het
Ubr5 T C 15: 37,989,598 N2019S probably benign Het
Wbp2 T C 11: 116,086,910 N6D probably benign Het
Wdr59 T A 8: 111,459,040 E810V possibly damaging Het
Wiz T C 17: 32,360,421 D220G probably damaging Het
Yipf7 A G 5: 69,517,070 L244P probably damaging Het
Zdhhc17 T C 10: 110,955,111 T366A possibly damaging Het
Zfp169 A T 13: 48,490,996 probably benign Het
Zfp707 C T 15: 75,969,723 probably benign Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Olfr553
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Olfr553 APN 7 102614172 missense probably benign 0.18
IGL01957:Olfr553 APN 7 102614339 missense probably damaging 0.98
IGL02720:Olfr553 APN 7 102614839 missense probably damaging 1.00
IGL03052:Olfr553 UTSW 7 102614449 missense probably benign 0.00
R1812:Olfr553 UTSW 7 102614370 missense possibly damaging 0.95
R1994:Olfr553 UTSW 7 102614540 missense probably damaging 0.97
R3406:Olfr553 UTSW 7 102614786 missense possibly damaging 0.92
R4575:Olfr553 UTSW 7 102614769 nonsense probably null
R5527:Olfr553 UTSW 7 102614561 missense probably benign
R7224:Olfr553 UTSW 7 102614767 missense probably damaging 1.00
R7603:Olfr553 UTSW 7 102614938 missense probably benign
R7823:Olfr553 UTSW 7 102614957 missense probably benign 0.00
R8260:Olfr553 UTSW 7 102614225 missense possibly damaging 0.91
R8542:Olfr553 UTSW 7 102614665 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTGGACAATCCTAACACAGC -3'
(R):5'- ACGCCTGCTTAGTTCAGATG -3'

Sequencing Primer
(F):5'- TAAGATGCAGTTATAGCTATGGAGTC -3'
(R):5'- AGTTCAGATGTTCTTTGTCCACTG -3'
Posted On 2018-10-18