Incidental Mutation 'R6823:Tmem161a'
ID 537736
Institutional Source Beutler Lab
Gene Symbol Tmem161a
Ensembl Gene ENSMUSG00000002342
Gene Name transmembrane protein 161A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock # R6823 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 70172356-70183681 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70181199 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 170 (L170P)
Ref Sequence ENSEMBL: ENSMUSP00000138499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002413] [ENSMUST00000063788] [ENSMUST00000110127] [ENSMUST00000147656] [ENSMUST00000149105] [ENSMUST00000182365] [ENSMUST00000182715] [ENSMUST00000182980]
AlphaFold Q8VCA6
Predicted Effect probably damaging
Transcript: ENSMUST00000002413
AA Change: L322P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002413
Gene: ENSMUSG00000002342
AA Change: L322P

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 2 478 6.8e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063788
SMART Domains Protein: ENSMUSP00000065903
Gene: ENSMUSG00000002346

DomainStartEndE-ValueType
Pfam:Mito_carr 29 122 3.4e-23 PFAM
Pfam:Mito_carr 127 219 1.4e-26 PFAM
Pfam:Mito_carr 222 316 3.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110127
SMART Domains Protein: ENSMUSP00000105754
Gene: ENSMUSG00000002346

DomainStartEndE-ValueType
Pfam:Mito_carr 29 122 1.6e-23 PFAM
Pfam:Mito_carr 127 219 7.2e-27 PFAM
Pfam:Mito_carr 222 317 3.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125906
SMART Domains Protein: ENSMUSP00000137791
Gene: ENSMUSG00000002342

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 1 119 8.7e-37 PFAM
Predicted Effect silent
Transcript: ENSMUST00000147656
SMART Domains Protein: ENSMUSP00000138017
Gene: ENSMUSG00000002342

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 2 270 4.6e-122 PFAM
low complexity region 283 296 N/A INTRINSIC
low complexity region 309 320 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000149105
AA Change: L296P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123084
Gene: ENSMUSG00000002342
AA Change: L296P

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 1 95 5.1e-41 PFAM
Pfam:Tmemb_161AB 93 454 9.5e-148 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182365
SMART Domains Protein: ENSMUSP00000138641
Gene: ENSMUSG00000002342

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 2 98 3.7e-42 PFAM
Predicted Effect silent
Transcript: ENSMUST00000182715
SMART Domains Protein: ENSMUSP00000138432
Gene: ENSMUSG00000002342

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 2 45 3.3e-15 PFAM
low complexity region 152 165 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182980
AA Change: L170P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138499
Gene: ENSMUSG00000002342
AA Change: L170P

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 1 328 4.6e-133 PFAM
Meta Mutation Damage Score 0.8160 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (81/83)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,754,886 probably null Het
Adgrv1 A G 13: 81,557,081 F1537L probably damaging Het
Aggf1 T C 13: 95,364,723 S384G probably benign Het
Anxa8 A T 14: 34,094,765 D204V possibly damaging Het
Asap3 A T 4: 136,227,572 E71V possibly damaging Het
BC024139 T C 15: 76,119,746 *773W probably null Het
Bckdhb T C 9: 83,953,761 V106A possibly damaging Het
Cep250 A G 2: 155,981,459 D1010G probably benign Het
Chrd T A 16: 20,734,736 L243Q probably damaging Het
Cib2 G T 9: 54,549,891 L30I possibly damaging Het
Cpsf7 T A 19: 10,532,884 L113* probably null Het
Cubn T A 2: 13,445,029 I895L probably benign Het
Cyp24a1 C A 2: 170,487,979 R351I probably benign Het
Cyp2a12 A T 7: 27,034,156 D320V possibly damaging Het
Dact1 C G 12: 71,317,939 P498R probably benign Het
Diaph1 T A 18: 37,876,383 probably null Het
Dnah7a A T 1: 53,456,704 I3198N probably benign Het
Dopey2 A T 16: 93,755,485 I271F possibly damaging Het
Erich3 C A 3: 154,727,437 F349L probably damaging Het
Fam187b G C 7: 30,989,290 V358L probably benign Het
Fat4 T A 3: 38,983,939 H3913Q probably benign Het
Fbxw7 G C 3: 84,958,627 E118D probably benign Het
Fgf1 A G 18: 38,847,108 I71T probably damaging Het
Fryl A T 5: 73,065,217 I2007K probably damaging Het
Galnt2 C G 8: 124,324,011 P130A probably benign Het
H1fx G A 6: 87,981,302 R19C probably damaging Het
Hmga2 A C 10: 120,476,024 S14A possibly damaging Het
Hoxb4 C T 11: 96,318,654 probably benign Het
Hr A T 14: 70,565,374 I756F probably damaging Het
Hrasls5 A T 19: 7,639,496 probably benign Het
Hspa1b A T 17: 34,958,185 S275T probably benign Het
Ikbkap A G 4: 56,787,939 Y331H probably damaging Het
Kcnh1 T C 1: 192,505,289 *99R probably null Het
Kit C A 5: 75,652,649 L864I probably benign Het
Klk14 A T 7: 43,694,456 K196* probably null Het
Lmod1 A G 1: 135,325,167 N53S probably damaging Het
Myh13 T C 11: 67,356,158 M1235T probably benign Het
Neurl3 T A 1: 36,268,704 K175* probably null Het
Nlgn2 T A 11: 69,825,924 K597M probably damaging Het
Npdc1 T C 2: 25,409,109 M306T probably damaging Het
Obscn C T 11: 59,067,943 probably null Het
Olfr404-ps1 T C 11: 74,239,696 L44P probably damaging Het
Olfr553 G A 7: 102,614,486 L168F probably damaging Het
Olfr913 T C 9: 38,594,905 I228T possibly damaging Het
Pbrm1 A T 14: 31,084,790 Y1042F probably damaging Het
Pclo T A 5: 14,677,907 probably benign Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Phf12 C T 11: 78,022,511 Q430* probably null Het
Pld3 C T 7: 27,535,897 R302H probably damaging Het
Plekha5 T C 6: 140,525,858 S112P probably benign Het
Pmfbp1 T A 8: 109,530,307 S548T possibly damaging Het
Ppa1 A T 10: 61,667,603 I220F probably damaging Het
Ppp2r3d A G 9: 124,439,078 probably benign Het
Psmg2 A T 18: 67,648,857 E164D possibly damaging Het
Rarb T C 14: 16,443,824 R155G probably damaging Het
Rnf215 T C 11: 4,136,609 L162S probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Rtkn2 G A 10: 68,026,632 V330M probably damaging Het
Slc16a4 A T 3: 107,311,498 I472F probably benign Het
Snx14 T C 9: 88,394,382 N617D possibly damaging Het
Spire2 T C 8: 123,356,727 V150A probably damaging Het
Sptbn1 C A 11: 30,114,787 R1904M probably damaging Het
Swap70 A G 7: 110,281,303 E575G possibly damaging Het
Tbxas1 A T 6: 38,919,153 M1L possibly damaging Het
Tenm3 A T 8: 48,256,837 V1688D probably damaging Het
Tgfbr3 A T 5: 107,149,914 S207T probably damaging Het
Timm44 A G 8: 4,267,282 F248L probably damaging Het
Tmem63a A T 1: 180,960,470 Y263F possibly damaging Het
Tnfsf9 C A 17: 57,105,513 L28I probably benign Het
Tph2 T A 10: 115,174,106 N183I probably benign Het
Ttyh1 T C 7: 4,122,529 I60T probably damaging Het
Ubn1 T G 16: 5,064,547 S48A probably damaging Het
Ubr5 T C 15: 37,989,598 N2019S probably benign Het
Wbp2 T C 11: 116,086,910 N6D probably benign Het
Wdr59 T A 8: 111,459,040 E810V possibly damaging Het
Wiz T C 17: 32,360,421 D220G probably damaging Het
Yipf7 A G 5: 69,517,070 L244P probably damaging Het
Zdhhc17 T C 10: 110,955,111 T366A possibly damaging Het
Zfp169 A T 13: 48,490,996 probably benign Het
Zfp707 C T 15: 75,969,723 probably benign Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Tmem161a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Tmem161a APN 8 70178974 missense probably damaging 1.00
IGL02425:Tmem161a APN 8 70176927 critical splice donor site probably null
IGL02597:Tmem161a APN 8 70182043 missense probably damaging 1.00
IGL02622:Tmem161a APN 8 70181237 nonsense probably null
PIT4431001:Tmem161a UTSW 8 70182024 missense probably damaging 0.99
R0498:Tmem161a UTSW 8 70180973 missense probably benign 0.00
R1881:Tmem161a UTSW 8 70180785 missense probably null 1.00
R1970:Tmem161a UTSW 8 70176909 missense probably damaging 1.00
R1971:Tmem161a UTSW 8 70176909 missense probably damaging 1.00
R2027:Tmem161a UTSW 8 70177520 missense probably damaging 1.00
R2384:Tmem161a UTSW 8 70177554 missense probably benign 0.00
R2870:Tmem161a UTSW 8 70178915 intron probably benign
R2872:Tmem161a UTSW 8 70178915 intron probably benign
R4271:Tmem161a UTSW 8 70181512 missense probably damaging 1.00
R4284:Tmem161a UTSW 8 70177426 intron probably benign
R4576:Tmem161a UTSW 8 70182063 splice site probably null
R4677:Tmem161a UTSW 8 70180947 splice site probably null
R6322:Tmem161a UTSW 8 70182114 missense probably damaging 1.00
R7452:Tmem161a UTSW 8 70177488 missense probably damaging 1.00
R7965:Tmem161a UTSW 8 70177504 start gained probably benign
R8269:Tmem161a UTSW 8 70181958 missense probably benign 0.01
R8695:Tmem161a UTSW 8 70174397 missense probably damaging 0.97
R9261:Tmem161a UTSW 8 70178922 missense probably damaging 0.98
R9355:Tmem161a UTSW 8 70181171 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAACATGACTTTCTCTGTGTG -3'
(R):5'- ACAGTCACGTAGCAGTAGACC -3'

Sequencing Primer
(F):5'- CATGACTTTCTCTGTGTGCGTTTTG -3'
(R):5'- ACGTAGCAGTAGACCCGGAC -3'
Posted On 2018-10-18