Incidental Mutation 'R6823:Bckdhb'
ID537743
Institutional Source Beutler Lab
Gene Symbol Bckdhb
Ensembl Gene ENSMUSG00000032263
Gene Namebranched chain ketoacid dehydrogenase E1, beta polypeptide
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6823 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location83925145-84124240 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83953761 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 106 (V106A)
Ref Sequence ENSEMBL: ENSMUSP00000139684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034801] [ENSMUST00000190166] [ENSMUST00000190637]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034801
AA Change: V38A

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034801
Gene: ENSMUSG00000032263
AA Change: V38A

DomainStartEndE-ValueType
Transket_pyr 1 176 4.92e-60 SMART
Pfam:Transketolase_C 191 312 1.5e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190166
AA Change: V38A

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140598
Gene: ENSMUSG00000032263
AA Change: V38A

DomainStartEndE-ValueType
Transket_pyr 1 176 4.92e-60 SMART
Pfam:Transketolase_C 191 309 3.1e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190637
AA Change: V106A

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139684
Gene: ENSMUSG00000032263
AA Change: V106A

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Transket_pyr 69 244 4.92e-60 SMART
Pfam:Transketolase_C 259 377 1.1e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: This gene encodes the beta chain of the branched chain alpha ketoacid dehydrogenase (Bckdh) complex. The encoded protein exists in a heterotetrameric complex containing the Bckdh alpha subunit to form the E1 catalytic component of Bckdh complex. The Bckdh complex catalyzes the oxidative decarboxylation of branched chain ketoacids to their corresponding acyl-CoA esters, during the catabolism of leucine, isoleucine and valine. In humans, certain mutations in this gene cause maple syrup urine disease. Alternative splicing results in multiple transcript variants encoding different isoforms. A pseudogene for this gene has been identified. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,754,886 probably null Het
Adgrv1 A G 13: 81,557,081 F1537L probably damaging Het
Aggf1 T C 13: 95,364,723 S384G probably benign Het
Anxa8 A T 14: 34,094,765 D204V possibly damaging Het
Asap3 A T 4: 136,227,572 E71V possibly damaging Het
BC024139 T C 15: 76,119,746 *773W probably null Het
Cep250 A G 2: 155,981,459 D1010G probably benign Het
Chrd T A 16: 20,734,736 L243Q probably damaging Het
Cib2 G T 9: 54,549,891 L30I possibly damaging Het
Cpsf7 T A 19: 10,532,884 L113* probably null Het
Cubn T A 2: 13,445,029 I895L probably benign Het
Cyp24a1 C A 2: 170,487,979 R351I probably benign Het
Cyp2a12 A T 7: 27,034,156 D320V possibly damaging Het
Dact1 C G 12: 71,317,939 P498R probably benign Het
Diaph1 T A 18: 37,876,383 probably null Het
Dnah7a A T 1: 53,456,704 I3198N probably benign Het
Dopey2 A T 16: 93,755,485 I271F possibly damaging Het
Erich3 C A 3: 154,727,437 F349L probably damaging Het
Fam187b G C 7: 30,989,290 V358L probably benign Het
Fat4 T A 3: 38,983,939 H3913Q probably benign Het
Fbxw7 G C 3: 84,958,627 E118D probably benign Het
Fgf1 A G 18: 38,847,108 I71T probably damaging Het
Fryl A T 5: 73,065,217 I2007K probably damaging Het
Galnt2 C G 8: 124,324,011 P130A probably benign Het
H1fx G A 6: 87,981,302 R19C probably damaging Het
Hmga2 A C 10: 120,476,024 S14A possibly damaging Het
Hoxb4 C T 11: 96,318,654 probably benign Het
Hr A T 14: 70,565,374 I756F probably damaging Het
Hrasls5 A T 19: 7,639,496 probably benign Het
Hspa1b A T 17: 34,958,185 S275T probably benign Het
Ikbkap A G 4: 56,787,939 Y331H probably damaging Het
Kcnh1 T C 1: 192,505,289 *99R probably null Het
Kit C A 5: 75,652,649 L864I probably benign Het
Klk14 A T 7: 43,694,456 K196* probably null Het
Lmod1 A G 1: 135,325,167 N53S probably damaging Het
Myh13 T C 11: 67,356,158 M1235T probably benign Het
Neurl3 T A 1: 36,268,704 K175* probably null Het
Nlgn2 T A 11: 69,825,924 K597M probably damaging Het
Npdc1 T C 2: 25,409,109 M306T probably damaging Het
Obscn C T 11: 59,067,943 probably null Het
Olfr404-ps1 T C 11: 74,239,696 L44P probably damaging Het
Olfr553 G A 7: 102,614,486 L168F probably damaging Het
Olfr913 T C 9: 38,594,905 I228T possibly damaging Het
Pbrm1 A T 14: 31,084,790 Y1042F probably damaging Het
Pclo T A 5: 14,677,907 probably benign Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Phf12 C T 11: 78,022,511 Q430* probably null Het
Pld3 C T 7: 27,535,897 R302H probably damaging Het
Plekha5 T C 6: 140,525,858 S112P probably benign Het
Pmfbp1 T A 8: 109,530,307 S548T possibly damaging Het
Ppa1 A T 10: 61,667,603 I220F probably damaging Het
Ppp2r3d A G 9: 124,439,078 probably benign Het
Psmg2 A T 18: 67,648,857 E164D possibly damaging Het
Rarb T C 14: 16,443,824 R155G probably damaging Het
Rnf215 T C 11: 4,136,609 L162S probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Rtkn2 G A 10: 68,026,632 V330M probably damaging Het
Slc16a4 A T 3: 107,311,498 I472F probably benign Het
Snx14 T C 9: 88,394,382 N617D possibly damaging Het
Spire2 T C 8: 123,356,727 V150A probably damaging Het
Sptbn1 C A 11: 30,114,787 R1904M probably damaging Het
Swap70 A G 7: 110,281,303 E575G possibly damaging Het
Tbxas1 A T 6: 38,919,153 M1L possibly damaging Het
Tenm3 A T 8: 48,256,837 V1688D probably damaging Het
Tgfbr3 A T 5: 107,149,914 S207T probably damaging Het
Timm44 A G 8: 4,267,282 F248L probably damaging Het
Tmem161a T C 8: 70,181,199 L170P probably damaging Het
Tmem63a A T 1: 180,960,470 Y263F possibly damaging Het
Tnfsf9 C A 17: 57,105,513 L28I probably benign Het
Tph2 T A 10: 115,174,106 N183I probably benign Het
Ttyh1 T C 7: 4,122,529 I60T probably damaging Het
Ubn1 T G 16: 5,064,547 S48A probably damaging Het
Ubr5 T C 15: 37,989,598 N2019S probably benign Het
Wbp2 T C 11: 116,086,910 N6D probably benign Het
Wdr59 T A 8: 111,459,040 E810V possibly damaging Het
Wiz T C 17: 32,360,421 D220G probably damaging Het
Yipf7 A G 5: 69,517,070 L244P probably damaging Het
Zdhhc17 T C 10: 110,955,111 T366A possibly damaging Het
Zfp169 A T 13: 48,490,996 probably benign Het
Zfp707 C T 15: 75,969,723 probably benign Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Bckdhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01973:Bckdhb APN 9 83991736 missense probably benign
IGL02537:Bckdhb APN 9 83989141 missense probably benign 0.07
IGL02808:Bckdhb APN 9 83988845 missense probably benign 0.05
R0608:Bckdhb UTSW 9 83953736 missense probably damaging 1.00
R1780:Bckdhb UTSW 9 83953783 critical splice donor site probably null
R3892:Bckdhb UTSW 9 83988810 missense probably damaging 1.00
R4825:Bckdhb UTSW 9 83988905 missense probably damaging 1.00
R6018:Bckdhb UTSW 9 84069184 missense probably benign 0.41
R7350:Bckdhb UTSW 9 84010326 missense possibly damaging 0.93
R7383:Bckdhb UTSW 9 83953713 missense possibly damaging 0.66
R7759:Bckdhb UTSW 9 84010326 missense probably damaging 0.96
R8269:Bckdhb UTSW 9 84122364 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTTGATCTTGCTGAGTTCTTAAAG -3'
(R):5'- TCAGATTTGGAGAAACCCAGC -3'

Sequencing Primer
(F):5'- ATCTTGCTGAGTTCTTAAAGTTTGG -3'
(R):5'- GATTTGGAGAAACCCAGCCCATAG -3'
Posted On2018-10-18