Incidental Mutation 'R6823:Snx14'
ID 537744
Institutional Source Beutler Lab
Gene Symbol Snx14
Ensembl Gene ENSMUSG00000032422
Gene Name sorting nexin 14
Synonyms C330035N22Rik, YR-14
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6823 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 88376750-88438958 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88394382 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 617 (N617D)
Ref Sequence ENSEMBL: ENSMUSP00000130116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126405] [ENSMUST00000165315] [ENSMUST00000173011] [ENSMUST00000173039] [ENSMUST00000174806]
AlphaFold Q8BHY8
Predicted Effect probably benign
Transcript: ENSMUST00000126405
SMART Domains Protein: ENSMUSP00000116773
Gene: ENSMUSG00000032422

DomainStartEndE-ValueType
transmembrane domain 57 76 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PXA 157 210 3.9e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165315
AA Change: N617D

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130116
Gene: ENSMUSG00000032422
AA Change: N617D

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 157 330 8.2e-49 PFAM
Pfam:RGS 363 495 4.3e-13 PFAM
PX 585 704 8.77e-13 SMART
low complexity region 771 785 N/A INTRINSIC
Pfam:Nexin_C 825 930 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173011
SMART Domains Protein: ENSMUSP00000133507
Gene: ENSMUSG00000032422

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 157 330 3.1e-49 PFAM
Pfam:RGS 363 482 3.1e-9 PFAM
low complexity region 499 513 N/A INTRINSIC
Pfam:Nexin_C 553 658 7.2e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173039
AA Change: N573D

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133624
Gene: ENSMUSG00000032422
AA Change: N573D

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 154 286 6.5e-33 PFAM
Pfam:RGS 319 451 2.6e-13 PFAM
PX 541 660 8.77e-13 SMART
low complexity region 727 741 N/A INTRINSIC
Pfam:Nexin_C 781 886 1.1e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174806
AA Change: N626D

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133533
Gene: ENSMUSG00000032422
AA Change: N626D

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 158 327 1.9e-44 PFAM
Pfam:RGS 363 495 1.3e-13 PFAM
PX 594 713 8.77e-13 SMART
low complexity region 780 794 N/A INTRINSIC
Pfam:Nexin_C 834 938 2.8e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family have a phox (PX) phosphoinositide binding domain and are involved in intracellular trafficking. The encoded protein also contains a regulator of G protein signaling (RGS) domain. Regulator of G protein signaling family members are regulatory molecules that act as GTPase activating proteins for G alpha subunits of heterotrimeric G proteins. Alternate splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,754,886 probably null Het
Adgrv1 A G 13: 81,557,081 F1537L probably damaging Het
Aggf1 T C 13: 95,364,723 S384G probably benign Het
Anxa8 A T 14: 34,094,765 D204V possibly damaging Het
Asap3 A T 4: 136,227,572 E71V possibly damaging Het
BC024139 T C 15: 76,119,746 *773W probably null Het
Bckdhb T C 9: 83,953,761 V106A possibly damaging Het
Cep250 A G 2: 155,981,459 D1010G probably benign Het
Chrd T A 16: 20,734,736 L243Q probably damaging Het
Cib2 G T 9: 54,549,891 L30I possibly damaging Het
Cpsf7 T A 19: 10,532,884 L113* probably null Het
Cubn T A 2: 13,445,029 I895L probably benign Het
Cyp24a1 C A 2: 170,487,979 R351I probably benign Het
Cyp2a12 A T 7: 27,034,156 D320V possibly damaging Het
Dact1 C G 12: 71,317,939 P498R probably benign Het
Diaph1 T A 18: 37,876,383 probably null Het
Dnah7a A T 1: 53,456,704 I3198N probably benign Het
Dopey2 A T 16: 93,755,485 I271F possibly damaging Het
Erich3 C A 3: 154,727,437 F349L probably damaging Het
Fam187b G C 7: 30,989,290 V358L probably benign Het
Fat4 T A 3: 38,983,939 H3913Q probably benign Het
Fbxw7 G C 3: 84,958,627 E118D probably benign Het
Fgf1 A G 18: 38,847,108 I71T probably damaging Het
Fryl A T 5: 73,065,217 I2007K probably damaging Het
Galnt2 C G 8: 124,324,011 P130A probably benign Het
H1fx G A 6: 87,981,302 R19C probably damaging Het
Hmga2 A C 10: 120,476,024 S14A possibly damaging Het
Hoxb4 C T 11: 96,318,654 probably benign Het
Hr A T 14: 70,565,374 I756F probably damaging Het
Hrasls5 A T 19: 7,639,496 probably benign Het
Hspa1b A T 17: 34,958,185 S275T probably benign Het
Ikbkap A G 4: 56,787,939 Y331H probably damaging Het
Kcnh1 T C 1: 192,505,289 *99R probably null Het
Kit C A 5: 75,652,649 L864I probably benign Het
Klk14 A T 7: 43,694,456 K196* probably null Het
Lmod1 A G 1: 135,325,167 N53S probably damaging Het
Myh13 T C 11: 67,356,158 M1235T probably benign Het
Neurl3 T A 1: 36,268,704 K175* probably null Het
Nlgn2 T A 11: 69,825,924 K597M probably damaging Het
Npdc1 T C 2: 25,409,109 M306T probably damaging Het
Obscn C T 11: 59,067,943 probably null Het
Olfr404-ps1 T C 11: 74,239,696 L44P probably damaging Het
Olfr553 G A 7: 102,614,486 L168F probably damaging Het
Olfr913 T C 9: 38,594,905 I228T possibly damaging Het
Pbrm1 A T 14: 31,084,790 Y1042F probably damaging Het
Pclo T A 5: 14,677,907 probably benign Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Phf12 C T 11: 78,022,511 Q430* probably null Het
Pld3 C T 7: 27,535,897 R302H probably damaging Het
Plekha5 T C 6: 140,525,858 S112P probably benign Het
Pmfbp1 T A 8: 109,530,307 S548T possibly damaging Het
Ppa1 A T 10: 61,667,603 I220F probably damaging Het
Ppp2r3d A G 9: 124,439,078 probably benign Het
Psmg2 A T 18: 67,648,857 E164D possibly damaging Het
Rarb T C 14: 16,443,824 R155G probably damaging Het
Rnf215 T C 11: 4,136,609 L162S probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Rtkn2 G A 10: 68,026,632 V330M probably damaging Het
Slc16a4 A T 3: 107,311,498 I472F probably benign Het
Spire2 T C 8: 123,356,727 V150A probably damaging Het
Sptbn1 C A 11: 30,114,787 R1904M probably damaging Het
Swap70 A G 7: 110,281,303 E575G possibly damaging Het
Tbxas1 A T 6: 38,919,153 M1L possibly damaging Het
Tenm3 A T 8: 48,256,837 V1688D probably damaging Het
Tgfbr3 A T 5: 107,149,914 S207T probably damaging Het
Timm44 A G 8: 4,267,282 F248L probably damaging Het
Tmem161a T C 8: 70,181,199 L170P probably damaging Het
Tmem63a A T 1: 180,960,470 Y263F possibly damaging Het
Tnfsf9 C A 17: 57,105,513 L28I probably benign Het
Tph2 T A 10: 115,174,106 N183I probably benign Het
Ttyh1 T C 7: 4,122,529 I60T probably damaging Het
Ubn1 T G 16: 5,064,547 S48A probably damaging Het
Ubr5 T C 15: 37,989,598 N2019S probably benign Het
Wbp2 T C 11: 116,086,910 N6D probably benign Het
Wdr59 T A 8: 111,459,040 E810V possibly damaging Het
Wiz T C 17: 32,360,421 D220G probably damaging Het
Yipf7 A G 5: 69,517,070 L244P probably damaging Het
Zdhhc17 T C 10: 110,955,111 T366A possibly damaging Het
Zfp169 A T 13: 48,490,996 probably benign Het
Zfp707 C T 15: 75,969,723 probably benign Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Snx14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Snx14 APN 9 88402190 missense probably damaging 0.99
IGL00773:Snx14 APN 9 88394539 missense probably damaging 0.96
IGL00847:Snx14 APN 9 88420329 missense probably damaging 1.00
IGL01526:Snx14 APN 9 88381500 missense probably damaging 0.99
IGL01662:Snx14 APN 9 88385838 splice site probably benign
IGL01928:Snx14 APN 9 88381512 missense probably benign 0.04
IGL02225:Snx14 APN 9 88413524 missense probably damaging 0.99
IGL02498:Snx14 APN 9 88407464 missense probably damaging 1.00
IGL02585:Snx14 APN 9 88404518 missense possibly damaging 0.92
IGL02634:Snx14 APN 9 88403303 missense probably damaging 1.00
IGL03073:Snx14 APN 9 88422896 critical splice donor site probably null
R0167:Snx14 UTSW 9 88407416 missense probably damaging 1.00
R0324:Snx14 UTSW 9 88405238 critical splice donor site probably null
R0627:Snx14 UTSW 9 88394430 missense probably benign
R0862:Snx14 UTSW 9 88383996 missense possibly damaging 0.81
R0864:Snx14 UTSW 9 88383996 missense possibly damaging 0.81
R0973:Snx14 UTSW 9 88400721 critical splice donor site probably null
R0973:Snx14 UTSW 9 88400721 critical splice donor site probably null
R0974:Snx14 UTSW 9 88400721 critical splice donor site probably null
R1478:Snx14 UTSW 9 88394528 missense probably benign 0.00
R1511:Snx14 UTSW 9 88398364 nonsense probably null
R1522:Snx14 UTSW 9 88402224 missense possibly damaging 0.52
R1612:Snx14 UTSW 9 88376905 missense possibly damaging 0.81
R1634:Snx14 UTSW 9 88385739 missense probably benign 0.00
R1634:Snx14 UTSW 9 88407490 splice site probably benign
R1704:Snx14 UTSW 9 88413538 missense probably damaging 1.00
R1713:Snx14 UTSW 9 88415675 missense probably damaging 1.00
R1883:Snx14 UTSW 9 88402261 missense probably benign 0.01
R3701:Snx14 UTSW 9 88420243 splice site probably benign
R3853:Snx14 UTSW 9 88407319 splice site probably benign
R4301:Snx14 UTSW 9 88410623 missense probably damaging 1.00
R4449:Snx14 UTSW 9 88422999 missense probably benign 0.05
R4793:Snx14 UTSW 9 88394442 missense probably damaging 0.98
R4934:Snx14 UTSW 9 88398288 missense probably damaging 0.98
R5126:Snx14 UTSW 9 88382099 missense probably damaging 1.00
R5227:Snx14 UTSW 9 88398294 missense possibly damaging 0.77
R5518:Snx14 UTSW 9 88383802 missense probably damaging 1.00
R5838:Snx14 UTSW 9 88391776 missense probably damaging 1.00
R5957:Snx14 UTSW 9 88403274 missense possibly damaging 0.84
R6153:Snx14 UTSW 9 88391806 missense probably damaging 1.00
R6156:Snx14 UTSW 9 88407339 missense possibly damaging 0.92
R6703:Snx14 UTSW 9 88422914 missense probably damaging 0.96
R6784:Snx14 UTSW 9 88381792 missense probably benign 0.01
R6837:Snx14 UTSW 9 88380223 missense probably benign 0.07
R7169:Snx14 UTSW 9 88398309 missense probably damaging 0.98
R7216:Snx14 UTSW 9 88381791 missense probably damaging 0.99
R7224:Snx14 UTSW 9 88394561 missense possibly damaging 0.92
R7357:Snx14 UTSW 9 88404316 missense possibly damaging 0.49
R7738:Snx14 UTSW 9 88407474 missense probably benign 0.00
R7743:Snx14 UTSW 9 88398349 missense probably benign 0.01
R7969:Snx14 UTSW 9 88413560 missense probably damaging 1.00
R8016:Snx14 UTSW 9 88415687 missense probably damaging 0.99
R8384:Snx14 UTSW 9 88403280 nonsense probably null
R8492:Snx14 UTSW 9 88381816 missense possibly damaging 0.94
R8686:Snx14 UTSW 9 88415693 missense probably damaging 1.00
R8738:Snx14 UTSW 9 88407400 missense possibly damaging 0.93
R8870:Snx14 UTSW 9 88413488 missense probably benign 0.01
R9208:Snx14 UTSW 9 88383779 missense probably benign 0.01
R9402:Snx14 UTSW 9 88407437 missense probably damaging 1.00
R9620:Snx14 UTSW 9 88381741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTAGATGTCAGGGGTCGG -3'
(R):5'- GTAATGGAGGATGACTCTCCAG -3'

Sequencing Primer
(F):5'- TCAGGGGTCGGGGAGTAC -3'
(R):5'- ATGACTCTCCAGTAGAAGCTGTG -3'
Posted On 2018-10-18