Incidental Mutation 'R6823:Rnf215'
ID 537751
Institutional Source Beutler Lab
Gene Symbol Rnf215
Ensembl Gene ENSMUSG00000003581
Gene Name ring finger protein 215
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock # R6823 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 4135202-4141172 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4136609 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 162 (L162S)
Ref Sequence ENSEMBL: ENSMUSP00000117540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003677] [ENSMUST00000093381] [ENSMUST00000101626] [ENSMUST00000124670] [ENSMUST00000145705]
AlphaFold Q5SPX3
Predicted Effect probably damaging
Transcript: ENSMUST00000003677
AA Change: L162S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003677
Gene: ENSMUSG00000003581
AA Change: L162S

DomainStartEndE-ValueType
signal peptide 1 45 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 149 162 N/A INTRINSIC
low complexity region 274 285 N/A INTRINSIC
RING 327 367 6.89e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093381
SMART Domains Protein: ENSMUSP00000091074
Gene: ENSMUSG00000051427

DomainStartEndE-ValueType
low complexity region 76 88 N/A INTRINSIC
low complexity region 321 343 N/A INTRINSIC
low complexity region 385 414 N/A INTRINSIC
SCOP:d1fxkc_ 452 595 4e-5 SMART
low complexity region 639 659 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101626
SMART Domains Protein: ENSMUSP00000099148
Gene: ENSMUSG00000051427

DomainStartEndE-ValueType
low complexity region 219 241 N/A INTRINSIC
low complexity region 283 312 N/A INTRINSIC
SCOP:d1fxkc_ 350 493 3e-4 SMART
low complexity region 537 557 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000124670
AA Change: L111S
SMART Domains Protein: ENSMUSP00000114532
Gene: ENSMUSG00000003581
AA Change: L111S

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
low complexity region 87 111 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145705
AA Change: L162S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117540
Gene: ENSMUSG00000003581
AA Change: L162S

DomainStartEndE-ValueType
signal peptide 1 45 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 149 162 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (81/83)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,754,886 probably null Het
Adgrv1 A G 13: 81,557,081 F1537L probably damaging Het
Aggf1 T C 13: 95,364,723 S384G probably benign Het
Anxa8 A T 14: 34,094,765 D204V possibly damaging Het
Asap3 A T 4: 136,227,572 E71V possibly damaging Het
BC024139 T C 15: 76,119,746 *773W probably null Het
Bckdhb T C 9: 83,953,761 V106A possibly damaging Het
Cep250 A G 2: 155,981,459 D1010G probably benign Het
Chrd T A 16: 20,734,736 L243Q probably damaging Het
Cib2 G T 9: 54,549,891 L30I possibly damaging Het
Cpsf7 T A 19: 10,532,884 L113* probably null Het
Cubn T A 2: 13,445,029 I895L probably benign Het
Cyp24a1 C A 2: 170,487,979 R351I probably benign Het
Cyp2a12 A T 7: 27,034,156 D320V possibly damaging Het
Dact1 C G 12: 71,317,939 P498R probably benign Het
Diaph1 T A 18: 37,876,383 probably null Het
Dnah7a A T 1: 53,456,704 I3198N probably benign Het
Dopey2 A T 16: 93,755,485 I271F possibly damaging Het
Erich3 C A 3: 154,727,437 F349L probably damaging Het
Fam187b G C 7: 30,989,290 V358L probably benign Het
Fat4 T A 3: 38,983,939 H3913Q probably benign Het
Fbxw7 G C 3: 84,958,627 E118D probably benign Het
Fgf1 A G 18: 38,847,108 I71T probably damaging Het
Fryl A T 5: 73,065,217 I2007K probably damaging Het
Galnt2 C G 8: 124,324,011 P130A probably benign Het
H1fx G A 6: 87,981,302 R19C probably damaging Het
Hmga2 A C 10: 120,476,024 S14A possibly damaging Het
Hoxb4 C T 11: 96,318,654 probably benign Het
Hr A T 14: 70,565,374 I756F probably damaging Het
Hrasls5 A T 19: 7,639,496 probably benign Het
Hspa1b A T 17: 34,958,185 S275T probably benign Het
Ikbkap A G 4: 56,787,939 Y331H probably damaging Het
Kcnh1 T C 1: 192,505,289 *99R probably null Het
Kit C A 5: 75,652,649 L864I probably benign Het
Klk14 A T 7: 43,694,456 K196* probably null Het
Lmod1 A G 1: 135,325,167 N53S probably damaging Het
Myh13 T C 11: 67,356,158 M1235T probably benign Het
Neurl3 T A 1: 36,268,704 K175* probably null Het
Nlgn2 T A 11: 69,825,924 K597M probably damaging Het
Npdc1 T C 2: 25,409,109 M306T probably damaging Het
Obscn C T 11: 59,067,943 probably null Het
Olfr404-ps1 T C 11: 74,239,696 L44P probably damaging Het
Olfr553 G A 7: 102,614,486 L168F probably damaging Het
Olfr913 T C 9: 38,594,905 I228T possibly damaging Het
Pbrm1 A T 14: 31,084,790 Y1042F probably damaging Het
Pclo T A 5: 14,677,907 probably benign Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Phf12 C T 11: 78,022,511 Q430* probably null Het
Pld3 C T 7: 27,535,897 R302H probably damaging Het
Plekha5 T C 6: 140,525,858 S112P probably benign Het
Pmfbp1 T A 8: 109,530,307 S548T possibly damaging Het
Ppa1 A T 10: 61,667,603 I220F probably damaging Het
Ppp2r3d A G 9: 124,439,078 probably benign Het
Psmg2 A T 18: 67,648,857 E164D possibly damaging Het
Rarb T C 14: 16,443,824 R155G probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Rtkn2 G A 10: 68,026,632 V330M probably damaging Het
Slc16a4 A T 3: 107,311,498 I472F probably benign Het
Snx14 T C 9: 88,394,382 N617D possibly damaging Het
Spire2 T C 8: 123,356,727 V150A probably damaging Het
Sptbn1 C A 11: 30,114,787 R1904M probably damaging Het
Swap70 A G 7: 110,281,303 E575G possibly damaging Het
Tbxas1 A T 6: 38,919,153 M1L possibly damaging Het
Tenm3 A T 8: 48,256,837 V1688D probably damaging Het
Tgfbr3 A T 5: 107,149,914 S207T probably damaging Het
Timm44 A G 8: 4,267,282 F248L probably damaging Het
Tmem161a T C 8: 70,181,199 L170P probably damaging Het
Tmem63a A T 1: 180,960,470 Y263F possibly damaging Het
Tnfsf9 C A 17: 57,105,513 L28I probably benign Het
Tph2 T A 10: 115,174,106 N183I probably benign Het
Ttyh1 T C 7: 4,122,529 I60T probably damaging Het
Ubn1 T G 16: 5,064,547 S48A probably damaging Het
Ubr5 T C 15: 37,989,598 N2019S probably benign Het
Wbp2 T C 11: 116,086,910 N6D probably benign Het
Wdr59 T A 8: 111,459,040 E810V possibly damaging Het
Wiz T C 17: 32,360,421 D220G probably damaging Het
Yipf7 A G 5: 69,517,070 L244P probably damaging Het
Zdhhc17 T C 10: 110,955,111 T366A possibly damaging Het
Zfp169 A T 13: 48,490,996 probably benign Het
Zfp707 C T 15: 75,969,723 probably benign Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Rnf215
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Rnf215 APN 11 4140317 missense probably damaging 1.00
IGL01973:Rnf215 APN 11 4136615 missense probably damaging 1.00
IGL02664:Rnf215 APN 11 4140307 missense probably damaging 0.98
IGL02724:Rnf215 APN 11 4140305 missense probably damaging 1.00
IGL02986:Rnf215 APN 11 4139793 missense probably damaging 0.99
IGL02988:Rnf215 UTSW 11 4136785 missense probably damaging 0.96
R0316:Rnf215 UTSW 11 4139760 missense probably damaging 0.99
R0693:Rnf215 UTSW 11 4140401 critical splice donor site probably null
R1297:Rnf215 UTSW 11 4139806 missense possibly damaging 0.60
R1519:Rnf215 UTSW 11 4135451 missense probably damaging 0.97
R1584:Rnf215 UTSW 11 4136719 missense probably damaging 0.99
R1778:Rnf215 UTSW 11 4135873 nonsense probably null
R5444:Rnf215 UTSW 11 4135843 missense probably benign 0.36
R5623:Rnf215 UTSW 11 4135453 missense probably benign 0.00
R5964:Rnf215 UTSW 11 4135898 missense probably benign 0.01
R7346:Rnf215 UTSW 11 4139792 nonsense probably null
R7635:Rnf215 UTSW 11 4139989 missense probably damaging 1.00
R8210:Rnf215 UTSW 11 4135544 missense possibly damaging 0.95
R8739:Rnf215 UTSW 11 4135959 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAACCATCGTGTGTTGCCTTTG -3'
(R):5'- CAGCTTGGTGACATTGGAGG -3'

Sequencing Primer
(F):5'- AAAACCATCCCTTAGCTTTGGC -3'
(R):5'- GAGTAATGGAGAACAATCACTGGCC -3'
Posted On 2018-10-18