Mutagenetix > Incidental Mutation

Incidental Mutation 'R6823:Hr'

537767

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000022096

Gene Name

hairless

Synonyms

ALUNC, AU, N, ba, bldy, hr, rh, rh-bmh, rhino

MMRRC Submission

044935-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6823 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70552212-70573548 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70565374 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 756 (I756F)

Ref Sequence

ENSEMBL: ENSMUSP00000124042 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022691] [ENSMUST00000161069] [ENSMUST00000163060]

AlphaFold

Q61645

Predicted Effect

probably damaging
Transcript: ENSMUST00000022691
AA Change: I727F

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000022691
Gene: ENSMUSG00000022096
AA Change: I727F

Domain	Start	End	E-Value	Type
Blast:JmjC	54	849	N/A	BLAST
JmjC	939	1150	5.23e-38	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000161069
AA Change: I727F

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124816
Gene: ENSMUSG00000022096
AA Change: I727F

Domain	Start	End	E-Value	Type
Blast:JmjC	54	849	N/A	BLAST
JmjC	939	1150	5.23e-38	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163060
AA Change: I756F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124042
Gene: ENSMUSG00000022096
AA Change: I756F

Domain	Start	End	E-Value	Type
low complexity region	12	21	N/A	INTRINSIC
Blast:JmjC	83	878	N/A	BLAST
JmjC	968	1179	5.23e-38	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

98% (81/83)

MGI Phenotype

FUNCTION: This gene encodes a protein that is involved in hair growth. This protein functions as a transcriptional corepressor of multiple nuclear receptors, including thyroid hormone receptor, the retinoic acid receptor-related orphan receptors and the vitamin D receptors, and it interacts with histone deacetylases. The translation of this protein is modulated by a regulatory ORF that exists upstream of the primary ORF. Mutations in this upstream ORF, U2HR, cause Marie Unna hereditary hypotrichosis (MUHH), an autosomal dominant form of genetic hair loss in human. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mutant homozygotes exhibit hair loss, usually wrinkled skin with epidermal cysts. Females do not nurse their pups well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	T	G	15: 64,754,886		probably null	Het
Adgrv1	A	G	13: 81,557,081	F1537L	probably damaging	Het
Aggf1	T	C	13: 95,364,723	S384G	probably benign	Het
Anxa8	A	T	14: 34,094,765	D204V	possibly damaging	Het
Asap3	A	T	4: 136,227,572	E71V	possibly damaging	Het
BC024139	T	C	15: 76,119,746	*773W	probably null	Het
Bckdhb	T	C	9: 83,953,761	V106A	possibly damaging	Het
Cep250	A	G	2: 155,981,459	D1010G	probably benign	Het
Chrd	T	A	16: 20,734,736	L243Q	probably damaging	Het
Cib2	G	T	9: 54,549,891	L30I	possibly damaging	Het
Cpsf7	T	A	19: 10,532,884	L113*	probably null	Het
Cubn	T	A	2: 13,445,029	I895L	probably benign	Het
Cyp24a1	C	A	2: 170,487,979	R351I	probably benign	Het
Cyp2a12	A	T	7: 27,034,156	D320V	possibly damaging	Het
Dact1	C	G	12: 71,317,939	P498R	probably benign	Het
Diaph1	T	A	18: 37,876,383		probably null	Het
Dnah7a	A	T	1: 53,456,704	I3198N	probably benign	Het
Dopey2	A	T	16: 93,755,485	I271F	possibly damaging	Het
Erich3	C	A	3: 154,727,437	F349L	probably damaging	Het
Fam187b	G	C	7: 30,989,290	V358L	probably benign	Het
Fat4	T	A	3: 38,983,939	H3913Q	probably benign	Het
Fbxw7	G	C	3: 84,958,627	E118D	probably benign	Het
Fgf1	A	G	18: 38,847,108	I71T	probably damaging	Het
Fryl	A	T	5: 73,065,217	I2007K	probably damaging	Het
Galnt2	C	G	8: 124,324,011	P130A	probably benign	Het
H1fx	G	A	6: 87,981,302	R19C	probably damaging	Het
Hmga2	A	C	10: 120,476,024	S14A	possibly damaging	Het
Hoxb4	C	T	11: 96,318,654		probably benign	Het
Hrasls5	A	T	19: 7,639,496		probably benign	Het
Hspa1b	A	T	17: 34,958,185	S275T	probably benign	Het
Ikbkap	A	G	4: 56,787,939	Y331H	probably damaging	Het
Kcnh1	T	C	1: 192,505,289	*99R	probably null	Het
Kit	C	A	5: 75,652,649	L864I	probably benign	Het
Klk14	A	T	7: 43,694,456	K196*	probably null	Het
Lmod1	A	G	1: 135,325,167	N53S	probably damaging	Het
Myh13	T	C	11: 67,356,158	M1235T	probably benign	Het
Neurl3	T	A	1: 36,268,704	K175*	probably null	Het
Nlgn2	T	A	11: 69,825,924	K597M	probably damaging	Het
Npdc1	T	C	2: 25,409,109	M306T	probably damaging	Het
Obscn	C	T	11: 59,067,943		probably null	Het
Olfr404-ps1	T	C	11: 74,239,696	L44P	probably damaging	Het
Olfr553	G	A	7: 102,614,486	L168F	probably damaging	Het
Olfr913	T	C	9: 38,594,905	I228T	possibly damaging	Het
Pbrm1	A	T	14: 31,084,790	Y1042F	probably damaging	Het
Pclo	T	A	5: 14,677,907		probably benign	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Phf12	C	T	11: 78,022,511	Q430*	probably null	Het
Pld3	C	T	7: 27,535,897	R302H	probably damaging	Het
Plekha5	T	C	6: 140,525,858	S112P	probably benign	Het
Pmfbp1	T	A	8: 109,530,307	S548T	possibly damaging	Het
Ppa1	A	T	10: 61,667,603	I220F	probably damaging	Het
Ppp2r3d	A	G	9: 124,439,078		probably benign	Het
Psmg2	A	T	18: 67,648,857	E164D	possibly damaging	Het
Rarb	T	C	14: 16,443,824	R155G	probably damaging	Het
Rnf215	T	C	11: 4,136,609	L162S	probably damaging	Het
Rsf1	GGCG	GGCGACGGCCGCG	7: 97,579,906		probably benign	Het
Rtkn2	G	A	10: 68,026,632	V330M	probably damaging	Het
Slc16a4	A	T	3: 107,311,498	I472F	probably benign	Het
Snx14	T	C	9: 88,394,382	N617D	possibly damaging	Het
Spire2	T	C	8: 123,356,727	V150A	probably damaging	Het
Sptbn1	C	A	11: 30,114,787	R1904M	probably damaging	Het
Swap70	A	G	7: 110,281,303	E575G	possibly damaging	Het
Tbxas1	A	T	6: 38,919,153	M1L	possibly damaging	Het
Tenm3	A	T	8: 48,256,837	V1688D	probably damaging	Het
Tgfbr3	A	T	5: 107,149,914	S207T	probably damaging	Het
Timm44	A	G	8: 4,267,282	F248L	probably damaging	Het
Tmem161a	T	C	8: 70,181,199	L170P	probably damaging	Het
Tmem63a	A	T	1: 180,960,470	Y263F	possibly damaging	Het
Tnfsf9	C	A	17: 57,105,513	L28I	probably benign	Het
Tph2	T	A	10: 115,174,106	N183I	probably benign	Het
Ttyh1	T	C	7: 4,122,529	I60T	probably damaging	Het
Ubn1	T	G	16: 5,064,547	S48A	probably damaging	Het
Ubr5	T	C	15: 37,989,598	N2019S	probably benign	Het
Wbp2	T	C	11: 116,086,910	N6D	probably benign	Het
Wdr59	T	A	8: 111,459,040	E810V	possibly damaging	Het
Wiz	T	C	17: 32,360,421	D220G	probably damaging	Het
Yipf7	A	G	5: 69,517,070	L244P	probably damaging	Het
Zdhhc17	T	C	10: 110,955,111	T366A	possibly damaging	Het
Zfp169	A	T	13: 48,490,996		probably benign	Het
Zfp707	C	T	15: 75,969,723		probably benign	Het
Zfp788	A	G	7: 41,649,560	H540R	probably damaging	Het

Other mutations in Hr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01805:Hr	APN	14	70565297	splice site	probably benign
IGL02020:Hr	APN	14	70556437	missense	probably benign	0.01
IGL02372:Hr	APN	14	70558350	missense	possibly damaging	0.94
IGL02380:Hr	APN	14	70557761	missense	probably damaging	0.98
IGL02554:Hr	APN	14	70559866	splice site	probably benign
IGL02949:Hr	APN	14	70559785	missense	possibly damaging	0.87
IGL03406:Hr	APN	14	70563420	critical splice donor site	probably null
angie	UTSW	14	70567833	missense	probably damaging	0.97
blofeld	UTSW	14	70568085	missense	probably damaging	1.00
general	UTSW	14	70563684	critical splice donor site	probably null
kaburo	UTSW	14		unclassified
mister_clean	UTSW	14	70560064	critical splice donor site	probably benign
mushroom	UTSW	14	70568085	missense	probably damaging	1.00
prune	UTSW	14	70571429	missense	probably damaging	1.00
ren	UTSW	14	70568085	missense	probably damaging	1.00
subclinical	UTSW	14	70561836	missense	possibly damaging	0.89
vessel	UTSW	14	70561865	nonsense	probably null
yuanxiao	UTSW	14	70571448	missense	probably damaging	1.00
R0018:Hr	UTSW	14	70558277	missense	probably benign
R0038:Hr	UTSW	14	70568085	missense	probably damaging	1.00
R0374:Hr	UTSW	14	70556476	missense	probably benign	0.01
R0511:Hr	UTSW	14	70561912	nonsense	probably null
R0609:Hr	UTSW	14	70559657	missense	probably benign
R1828:Hr	UTSW	14	70572037	critical splice donor site	probably null
R2030:Hr	UTSW	14	70571448	missense	probably damaging	1.00
R2266:Hr	UTSW	14	70558107	missense	probably benign
R2267:Hr	UTSW	14	70558107	missense	probably benign
R2268:Hr	UTSW	14	70558107	missense	probably benign
R2377:Hr	UTSW	14	70557878	missense	probably damaging	1.00
R3686:Hr	UTSW	14	70557796	missense	probably damaging	0.98
R3687:Hr	UTSW	14	70557796	missense	probably damaging	0.98
R3754:Hr	UTSW	14	70567824	missense	probably damaging	1.00
R3803:Hr	UTSW	14	70557893	missense	probably benign	0.01
R3846:Hr	UTSW	14	70571453	missense	probably damaging	1.00
R3977:Hr	UTSW	14	70563584	missense	probably benign	0.01
R3978:Hr	UTSW	14	70563584	missense	probably benign	0.01
R3979:Hr	UTSW	14	70563584	missense	probably benign	0.01
R4528:Hr	UTSW	14	70566383	missense	probably damaging	1.00
R4654:Hr	UTSW	14	70563573	missense	probably damaging	0.99
R4834:Hr	UTSW	14	70559922	missense	probably damaging	0.98
R4847:Hr	UTSW	14	70556476	missense	probably benign	0.04
R4863:Hr	UTSW	14	70571972	missense	probably damaging	1.00
R5292:Hr	UTSW	14	70571992	missense	probably damaging	1.00
R5452:Hr	UTSW	14	70556627	missense	probably damaging	1.00
R5717:Hr	UTSW	14	70566176	missense	probably benign	0.34
R5902:Hr	UTSW	14	70557791	missense	probably benign	0.02
R6000:Hr	UTSW	14	70567833	missense	probably damaging	0.97
R6439:Hr	UTSW	14	70561836	missense	possibly damaging	0.89
R7030:Hr	UTSW	14	70563684	critical splice donor site	probably null
R7213:Hr	UTSW	14	70558350	missense	probably damaging	0.99
R7452:Hr	UTSW	14	70571486	missense	probably damaging	1.00
R7468:Hr	UTSW	14	70558212	missense	possibly damaging	0.89
R7572:Hr	UTSW	14	70561853	missense	possibly damaging	0.66
R7956:Hr	UTSW	14	70559887	missense	probably benign
R7996:Hr	UTSW	14	70563603	nonsense	probably null
R7997:Hr	UTSW	14	70563603	nonsense	probably null
R8076:Hr	UTSW	14	70557941	missense	probably benign	0.00
R8101:Hr	UTSW	14	70567842	missense	possibly damaging	0.67
R8553:Hr	UTSW	14	70567525	missense	probably damaging	1.00
R8749:Hr	UTSW	14	70558070	missense	probably damaging	1.00
R8850:Hr	UTSW	14	70561865	nonsense	probably null
R8949:Hr	UTSW	14	70557888	missense	probably benign	0.01
R9139:Hr	UTSW	14	70557639	missense	possibly damaging	0.65
R9236:Hr	UTSW	14	70571956	missense	probably damaging	1.00
R9246:Hr	UTSW	14	70571475	missense	probably damaging	1.00
R9327:Hr	UTSW	14	70567788	missense	possibly damaging	0.91
R9337:Hr	UTSW	14	70559884	missense	probably benign	0.00
R9487:Hr	UTSW	14	70556437	missense	probably benign	0.01
R9487:Hr	UTSW	14	70556765	missense	possibly damaging	0.77
R9700:Hr	UTSW	14	70567176	missense	probably benign	0.00
X0025:Hr	UTSW	14	70566951	splice site	probably null
X0026:Hr	UTSW	14	70567841	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCTGGCAAACAACTTCAGGAC -3'
(R):5'- TTGGGACACCTGTCTTGAGG -3'

Sequencing Primer
(F):5'- GGTGACTCACAACTGTCTATAGC -3'
(R):5'- CTTGAGGAGAGGGATGGCCATTC -3'

Posted On

2018-10-18