Incidental Mutation 'R6823:BC024139'
ID 537771
Institutional Source Beutler Lab
Gene Symbol BC024139
Ensembl Gene ENSMUSG00000044361
Gene Name cDNA sequence BC024139
Synonyms 6230424I18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R6823 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 76119517-76126596 bp(-) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) T to C at 76119746 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Tryptophan at position 773 (*773W)
Ref Sequence ENSEMBL: ENSMUSP00000053305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054022] [ENSMUST00000089654] [ENSMUST00000146157] [ENSMUST00000226781]
AlphaFold Q8BVJ3
Predicted Effect probably null
Transcript: ENSMUST00000054022
AA Change: *773W
SMART Domains Protein: ENSMUSP00000053305
Gene: ENSMUSG00000044361
AA Change: *773W

DomainStartEndE-ValueType
low complexity region 61 79 N/A INTRINSIC
SPEC 91 177 8.82e-1 SMART
SPEC 184 283 2.74e-2 SMART
coiled coil region 314 337 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
Pfam:GAS2 672 701 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089654
SMART Domains Protein: ENSMUSP00000087082
Gene: ENSMUSG00000044361

DomainStartEndE-ValueType
low complexity region 61 79 N/A INTRINSIC
SPEC 91 177 8.82e-1 SMART
SPEC 184 283 2.74e-2 SMART
coiled coil region 314 337 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
Pfam:GAS2 671 703 3.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146157
SMART Domains Protein: ENSMUSP00000117783
Gene: ENSMUSG00000044361

DomainStartEndE-ValueType
low complexity region 61 79 N/A INTRINSIC
SPEC 91 177 8.82e-1 SMART
SPEC 184 283 2.74e-2 SMART
coiled coil region 314 337 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226781
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (81/83)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,754,886 probably null Het
Adgrv1 A G 13: 81,557,081 F1537L probably damaging Het
Aggf1 T C 13: 95,364,723 S384G probably benign Het
Anxa8 A T 14: 34,094,765 D204V possibly damaging Het
Asap3 A T 4: 136,227,572 E71V possibly damaging Het
Bckdhb T C 9: 83,953,761 V106A possibly damaging Het
Cep250 A G 2: 155,981,459 D1010G probably benign Het
Chrd T A 16: 20,734,736 L243Q probably damaging Het
Cib2 G T 9: 54,549,891 L30I possibly damaging Het
Cpsf7 T A 19: 10,532,884 L113* probably null Het
Cubn T A 2: 13,445,029 I895L probably benign Het
Cyp24a1 C A 2: 170,487,979 R351I probably benign Het
Cyp2a12 A T 7: 27,034,156 D320V possibly damaging Het
Dact1 C G 12: 71,317,939 P498R probably benign Het
Diaph1 T A 18: 37,876,383 probably null Het
Dnah7a A T 1: 53,456,704 I3198N probably benign Het
Dopey2 A T 16: 93,755,485 I271F possibly damaging Het
Erich3 C A 3: 154,727,437 F349L probably damaging Het
Fam187b G C 7: 30,989,290 V358L probably benign Het
Fat4 T A 3: 38,983,939 H3913Q probably benign Het
Fbxw7 G C 3: 84,958,627 E118D probably benign Het
Fgf1 A G 18: 38,847,108 I71T probably damaging Het
Fryl A T 5: 73,065,217 I2007K probably damaging Het
Galnt2 C G 8: 124,324,011 P130A probably benign Het
H1fx G A 6: 87,981,302 R19C probably damaging Het
Hmga2 A C 10: 120,476,024 S14A possibly damaging Het
Hoxb4 C T 11: 96,318,654 probably benign Het
Hr A T 14: 70,565,374 I756F probably damaging Het
Hrasls5 A T 19: 7,639,496 probably benign Het
Hspa1b A T 17: 34,958,185 S275T probably benign Het
Ikbkap A G 4: 56,787,939 Y331H probably damaging Het
Kcnh1 T C 1: 192,505,289 *99R probably null Het
Kit C A 5: 75,652,649 L864I probably benign Het
Klk14 A T 7: 43,694,456 K196* probably null Het
Lmod1 A G 1: 135,325,167 N53S probably damaging Het
Myh13 T C 11: 67,356,158 M1235T probably benign Het
Neurl3 T A 1: 36,268,704 K175* probably null Het
Nlgn2 T A 11: 69,825,924 K597M probably damaging Het
Npdc1 T C 2: 25,409,109 M306T probably damaging Het
Obscn C T 11: 59,067,943 probably null Het
Olfr404-ps1 T C 11: 74,239,696 L44P probably damaging Het
Olfr553 G A 7: 102,614,486 L168F probably damaging Het
Olfr913 T C 9: 38,594,905 I228T possibly damaging Het
Pbrm1 A T 14: 31,084,790 Y1042F probably damaging Het
Pclo T A 5: 14,677,907 probably benign Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Phf12 C T 11: 78,022,511 Q430* probably null Het
Pld3 C T 7: 27,535,897 R302H probably damaging Het
Plekha5 T C 6: 140,525,858 S112P probably benign Het
Pmfbp1 T A 8: 109,530,307 S548T possibly damaging Het
Ppa1 A T 10: 61,667,603 I220F probably damaging Het
Ppp2r3d A G 9: 124,439,078 probably benign Het
Psmg2 A T 18: 67,648,857 E164D possibly damaging Het
Rarb T C 14: 16,443,824 R155G probably damaging Het
Rnf215 T C 11: 4,136,609 L162S probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Rtkn2 G A 10: 68,026,632 V330M probably damaging Het
Slc16a4 A T 3: 107,311,498 I472F probably benign Het
Snx14 T C 9: 88,394,382 N617D possibly damaging Het
Spire2 T C 8: 123,356,727 V150A probably damaging Het
Sptbn1 C A 11: 30,114,787 R1904M probably damaging Het
Swap70 A G 7: 110,281,303 E575G possibly damaging Het
Tbxas1 A T 6: 38,919,153 M1L possibly damaging Het
Tenm3 A T 8: 48,256,837 V1688D probably damaging Het
Tgfbr3 A T 5: 107,149,914 S207T probably damaging Het
Timm44 A G 8: 4,267,282 F248L probably damaging Het
Tmem161a T C 8: 70,181,199 L170P probably damaging Het
Tmem63a A T 1: 180,960,470 Y263F possibly damaging Het
Tnfsf9 C A 17: 57,105,513 L28I probably benign Het
Tph2 T A 10: 115,174,106 N183I probably benign Het
Ttyh1 T C 7: 4,122,529 I60T probably damaging Het
Ubn1 T G 16: 5,064,547 S48A probably damaging Het
Ubr5 T C 15: 37,989,598 N2019S probably benign Het
Wbp2 T C 11: 116,086,910 N6D probably benign Het
Wdr59 T A 8: 111,459,040 E810V possibly damaging Het
Wiz T C 17: 32,360,421 D220G probably damaging Het
Yipf7 A G 5: 69,517,070 L244P probably damaging Het
Zdhhc17 T C 10: 110,955,111 T366A possibly damaging Het
Zfp169 A T 13: 48,490,996 probably benign Het
Zfp707 C T 15: 75,969,723 probably benign Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in BC024139
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:BC024139 APN 15 76125100 missense probably benign 0.06
IGL01684:BC024139 APN 15 76124685 missense probably damaging 1.00
IGL01780:BC024139 APN 15 76121143 missense probably benign 0.01
IGL03084:BC024139 APN 15 76119807 missense probably benign 0.00
IGL03242:BC024139 APN 15 76120320 missense probably benign 0.32
IGL03386:BC024139 APN 15 76121745 missense probably benign 0.18
R0018:BC024139 UTSW 15 76120887 nonsense probably null
R0018:BC024139 UTSW 15 76120887 nonsense probably null
R0153:BC024139 UTSW 15 76121747 missense probably damaging 0.96
R0789:BC024139 UTSW 15 76121083 missense possibly damaging 0.51
R1158:BC024139 UTSW 15 76120342 unclassified probably benign
R1515:BC024139 UTSW 15 76124326 missense possibly damaging 0.83
R1840:BC024139 UTSW 15 76120642 missense probably benign
R1845:BC024139 UTSW 15 76125261 nonsense probably null
R2159:BC024139 UTSW 15 76121488 missense probably damaging 0.96
R2264:BC024139 UTSW 15 76125917 missense probably damaging 1.00
R2680:BC024139 UTSW 15 76121739 missense probably damaging 0.98
R2697:BC024139 UTSW 15 76120193 unclassified probably benign
R4113:BC024139 UTSW 15 76121627 missense probably benign 0.35
R4630:BC024139 UTSW 15 76125094 missense probably benign 0.23
R4825:BC024139 UTSW 15 76120317 missense possibly damaging 0.84
R4865:BC024139 UTSW 15 76126066 missense possibly damaging 0.56
R5208:BC024139 UTSW 15 76124665 missense probably benign 0.03
R5369:BC024139 UTSW 15 76120222 missense probably benign 0.02
R5371:BC024139 UTSW 15 76120686 makesense probably null
R5897:BC024139 UTSW 15 76126139 missense possibly damaging 0.84
R6110:BC024139 UTSW 15 76119796 missense probably benign
R6374:BC024139 UTSW 15 76120457 critical splice donor site probably null
R6915:BC024139 UTSW 15 76120021 missense probably benign
R7075:BC024139 UTSW 15 76124399 missense probably benign 0.06
R7669:BC024139 UTSW 15 76120568 missense possibly damaging 0.93
R8340:BC024139 UTSW 15 76121470 missense probably benign 0.03
R8355:BC024139 UTSW 15 76119807 missense probably benign 0.00
R8455:BC024139 UTSW 15 76119807 missense probably benign 0.00
R8481:BC024139 UTSW 15 76120682 missense probably damaging 0.99
R8507:BC024139 UTSW 15 76120133 missense possibly damaging 0.53
R8804:BC024139 UTSW 15 76124084 missense possibly damaging 0.92
R8876:BC024139 UTSW 15 76126120 missense possibly damaging 0.86
R9213:BC024139 UTSW 15 76125222 missense probably benign 0.00
R9542:BC024139 UTSW 15 76125515 missense probably damaging 0.99
R9555:BC024139 UTSW 15 76121159 missense possibly damaging 0.68
X0066:BC024139 UTSW 15 76124002 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTCTTTATTGCTGAGAGTGAGAG -3'
(R):5'- ATGCTGGGTCCTTCAGATGG -3'

Sequencing Primer
(F):5'- TTATTGCTGAGAGTGAGAGACATGCC -3'
(R):5'- GACTGAGGAACTTATTTGAGCCCC -3'
Posted On 2018-10-18