Incidental Mutation 'R6823:Ubn1'
ID 537772
Institutional Source Beutler Lab
Gene Symbol Ubn1
Ensembl Gene ENSMUSG00000039473
Gene Name ubinuclein 1
Synonyms 1110029L11Rik, 2610108L02Rik
MMRRC Submission 044935-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.662) question?
Stock # R6823 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 4867921-4904153 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 4882411 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 48 (S48A)
Ref Sequence ENSEMBL: ENSMUSP00000155604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052449] [ENSMUST00000229126] [ENSMUST00000229570] [ENSMUST00000230703]
AlphaFold Q4G0F8
Predicted Effect probably damaging
Transcript: ENSMUST00000052449
AA Change: S291A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000061843
Gene: ENSMUSG00000039473
AA Change: S291A

DomainStartEndE-ValueType
Pfam:HUN 117 168 1.4e-22 PFAM
low complexity region 181 224 N/A INTRINSIC
low complexity region 232 238 N/A INTRINSIC
low complexity region 250 267 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
Pfam:UBN_AB 353 573 2.4e-80 PFAM
low complexity region 792 804 N/A INTRINSIC
low complexity region 856 882 N/A INTRINSIC
low complexity region 905 934 N/A INTRINSIC
low complexity region 970 984 N/A INTRINSIC
low complexity region 996 1006 N/A INTRINSIC
low complexity region 1016 1034 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229126
AA Change: S291A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000229570
AA Change: S48A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000230703
AA Change: S291A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cellular senescence is a hallmark of tumor suppression and tissue aging. Senescent cells contain domains of heterochromatin, called senescence-associated heterochromatin foci (SAHF), that repress proliferation-promoting genes. The protein encoded by this gene binds to proliferation-promoting genes and is required for SAHF formation, enhancing methylation of histone H3. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,626,735 (GRCm39) probably null Het
Adgrv1 A G 13: 81,705,200 (GRCm39) F1537L probably damaging Het
Aggf1 T C 13: 95,501,231 (GRCm39) S384G probably benign Het
Anxa8 A T 14: 33,816,722 (GRCm39) D204V possibly damaging Het
Asap3 A T 4: 135,954,883 (GRCm39) E71V possibly damaging Het
BC024139 T C 15: 76,003,946 (GRCm39) *773W probably null Het
Bckdhb T C 9: 83,835,814 (GRCm39) V106A possibly damaging Het
Cep250 A G 2: 155,823,379 (GRCm39) D1010G probably benign Het
Chrd T A 16: 20,553,486 (GRCm39) L243Q probably damaging Het
Cib2 G T 9: 54,457,175 (GRCm39) L30I possibly damaging Het
Cpsf7 T A 19: 10,510,248 (GRCm39) L113* probably null Het
Cubn T A 2: 13,449,840 (GRCm39) I895L probably benign Het
Cyp24a1 C A 2: 170,329,899 (GRCm39) R351I probably benign Het
Cyp2a12 A T 7: 26,733,581 (GRCm39) D320V possibly damaging Het
Dact1 C G 12: 71,364,713 (GRCm39) P498R probably benign Het
Diaph1 T A 18: 38,009,436 (GRCm39) probably null Het
Dnah7a A T 1: 53,495,863 (GRCm39) I3198N probably benign Het
Dop1b A T 16: 93,552,373 (GRCm39) I271F possibly damaging Het
Elp1 A G 4: 56,787,939 (GRCm39) Y331H probably damaging Het
Erich3 C A 3: 154,433,074 (GRCm39) F349L probably damaging Het
Fam187b G C 7: 30,688,715 (GRCm39) V358L probably benign Het
Fat4 T A 3: 39,038,088 (GRCm39) H3913Q probably benign Het
Fbxw7 G C 3: 84,865,934 (GRCm39) E118D probably benign Het
Fgf1 A G 18: 38,980,161 (GRCm39) I71T probably damaging Het
Fryl A T 5: 73,222,560 (GRCm39) I2007K probably damaging Het
Galnt2 C G 8: 125,050,750 (GRCm39) P130A probably benign Het
H1f10 G A 6: 87,958,284 (GRCm39) R19C probably damaging Het
Hmga2 A C 10: 120,311,929 (GRCm39) S14A possibly damaging Het
Hoxb4 C T 11: 96,209,480 (GRCm39) probably benign Het
Hr A T 14: 70,802,814 (GRCm39) I756F probably damaging Het
Hspa1b A T 17: 35,177,161 (GRCm39) S275T probably benign Het
Kcnh1 T C 1: 192,187,597 (GRCm39) *99R probably null Het
Kit C A 5: 75,813,309 (GRCm39) L864I probably benign Het
Klk14 A T 7: 43,343,880 (GRCm39) K196* probably null Het
Lmod1 A G 1: 135,252,905 (GRCm39) N53S probably damaging Het
Myh13 T C 11: 67,246,984 (GRCm39) M1235T probably benign Het
Neurl3 T A 1: 36,307,785 (GRCm39) K175* probably null Het
Nlgn2 T A 11: 69,716,750 (GRCm39) K597M probably damaging Het
Npdc1 T C 2: 25,299,121 (GRCm39) M306T probably damaging Het
Obscn C T 11: 58,958,769 (GRCm39) probably null Het
Or1p1b T C 11: 74,130,522 (GRCm39) L44P probably damaging Het
Or52m2 G A 7: 102,263,693 (GRCm39) L168F probably damaging Het
Or8b49 T C 9: 38,506,201 (GRCm39) I228T possibly damaging Het
Pbrm1 A T 14: 30,806,747 (GRCm39) Y1042F probably damaging Het
Pclo T A 5: 14,727,921 (GRCm39) probably benign Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 (GRCm39) probably benign Het
Phf12 C T 11: 77,913,337 (GRCm39) Q430* probably null Het
Plaat5 A T 19: 7,616,861 (GRCm39) probably benign Het
Pld3 C T 7: 27,235,322 (GRCm39) R302H probably damaging Het
Plekha5 T C 6: 140,471,584 (GRCm39) S112P probably benign Het
Pmfbp1 T A 8: 110,256,939 (GRCm39) S548T possibly damaging Het
Ppa1 A T 10: 61,503,382 (GRCm39) I220F probably damaging Het
Ppp2r3d A G 9: 124,439,078 (GRCm38) probably benign Het
Psmg2 A T 18: 67,781,927 (GRCm39) E164D possibly damaging Het
Rarb T C 14: 16,443,824 (GRCm38) R155G probably damaging Het
Rnf215 T C 11: 4,086,609 (GRCm39) L162S probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Rtkn2 G A 10: 67,862,462 (GRCm39) V330M probably damaging Het
Slc16a4 A T 3: 107,218,814 (GRCm39) I472F probably benign Het
Snx14 T C 9: 88,276,435 (GRCm39) N617D possibly damaging Het
Spire2 T C 8: 124,083,466 (GRCm39) V150A probably damaging Het
Sptbn1 C A 11: 30,064,787 (GRCm39) R1904M probably damaging Het
Swap70 A G 7: 109,880,510 (GRCm39) E575G possibly damaging Het
Tbxas1 A T 6: 38,896,087 (GRCm39) M1L possibly damaging Het
Tenm3 A T 8: 48,709,872 (GRCm39) V1688D probably damaging Het
Tgfbr3 A T 5: 107,297,780 (GRCm39) S207T probably damaging Het
Timm44 A G 8: 4,317,282 (GRCm39) F248L probably damaging Het
Tmem161a T C 8: 70,633,849 (GRCm39) L170P probably damaging Het
Tmem63a A T 1: 180,788,035 (GRCm39) Y263F possibly damaging Het
Tnfsf9 C A 17: 57,412,513 (GRCm39) L28I probably benign Het
Tph2 T A 10: 115,010,011 (GRCm39) N183I probably benign Het
Ttyh1 T C 7: 4,125,528 (GRCm39) I60T probably damaging Het
Ubr5 T C 15: 37,989,842 (GRCm39) N2019S probably benign Het
Wbp2 T C 11: 115,977,736 (GRCm39) N6D probably benign Het
Wdr59 T A 8: 112,185,672 (GRCm39) E810V possibly damaging Het
Wiz T C 17: 32,579,395 (GRCm39) D220G probably damaging Het
Yipf7 A G 5: 69,674,413 (GRCm39) L244P probably damaging Het
Zdhhc17 T C 10: 110,790,972 (GRCm39) T366A possibly damaging Het
Zfp169 A T 13: 48,644,472 (GRCm39) probably benign Het
Zfp707 C T 15: 75,841,572 (GRCm39) probably benign Het
Zfp788 A G 7: 41,298,984 (GRCm39) H540R probably damaging Het
Other mutations in Ubn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Ubn1 APN 16 4,899,778 (GRCm39) missense probably benign 0.00
IGL01726:Ubn1 APN 16 4,891,334 (GRCm39) critical splice donor site probably null
IGL01744:Ubn1 APN 16 4,889,923 (GRCm39) missense probably damaging 1.00
IGL01777:Ubn1 APN 16 4,890,013 (GRCm39) missense possibly damaging 0.46
IGL02110:Ubn1 APN 16 4,899,754 (GRCm39) splice site probably benign
IGL02667:Ubn1 APN 16 4,880,463 (GRCm39) missense probably damaging 1.00
IGL03345:Ubn1 APN 16 4,899,828 (GRCm39) missense probably damaging 0.98
R0201:Ubn1 UTSW 16 4,882,478 (GRCm39) missense probably damaging 1.00
R0437:Ubn1 UTSW 16 4,890,048 (GRCm39) critical splice donor site probably benign
R0514:Ubn1 UTSW 16 4,890,935 (GRCm39) missense probably damaging 1.00
R0550:Ubn1 UTSW 16 4,880,484 (GRCm39) splice site probably null
R0919:Ubn1 UTSW 16 4,882,255 (GRCm39) missense probably damaging 1.00
R1183:Ubn1 UTSW 16 4,882,406 (GRCm39) missense probably damaging 1.00
R1339:Ubn1 UTSW 16 4,873,199 (GRCm39) missense probably damaging 0.99
R1440:Ubn1 UTSW 16 4,895,158 (GRCm39) missense probably damaging 1.00
R1836:Ubn1 UTSW 16 4,895,255 (GRCm39) missense probably benign
R2024:Ubn1 UTSW 16 4,882,487 (GRCm39) missense probably damaging 1.00
R2026:Ubn1 UTSW 16 4,882,514 (GRCm39) missense probably damaging 1.00
R2105:Ubn1 UTSW 16 4,895,088 (GRCm39) nonsense probably null
R2896:Ubn1 UTSW 16 4,873,083 (GRCm39) missense possibly damaging 0.60
R3418:Ubn1 UTSW 16 4,892,243 (GRCm39) splice site probably benign
R3721:Ubn1 UTSW 16 4,891,242 (GRCm39) missense possibly damaging 0.59
R4033:Ubn1 UTSW 16 4,882,475 (GRCm39) missense probably damaging 1.00
R4398:Ubn1 UTSW 16 4,882,289 (GRCm39) missense probably damaging 0.99
R4547:Ubn1 UTSW 16 4,889,956 (GRCm39) missense probably damaging 1.00
R4646:Ubn1 UTSW 16 4,895,851 (GRCm39) missense probably damaging 0.99
R4870:Ubn1 UTSW 16 4,895,177 (GRCm39) missense probably damaging 1.00
R5018:Ubn1 UTSW 16 4,881,589 (GRCm39) missense probably damaging 1.00
R5220:Ubn1 UTSW 16 4,895,818 (GRCm39) missense probably benign 0.02
R5394:Ubn1 UTSW 16 4,892,233 (GRCm39) missense possibly damaging 0.51
R6217:Ubn1 UTSW 16 4,895,096 (GRCm39) missense probably damaging 1.00
R6372:Ubn1 UTSW 16 4,899,502 (GRCm39) missense possibly damaging 0.84
R6418:Ubn1 UTSW 16 4,899,791 (GRCm39) missense probably benign
R7028:Ubn1 UTSW 16 4,873,188 (GRCm39) missense probably damaging 1.00
R7203:Ubn1 UTSW 16 4,895,080 (GRCm39) missense possibly damaging 0.57
R7498:Ubn1 UTSW 16 4,894,969 (GRCm39) missense probably damaging 0.99
R7596:Ubn1 UTSW 16 4,899,422 (GRCm39) missense probably benign 0.25
R8383:Ubn1 UTSW 16 4,895,222 (GRCm39) missense possibly damaging 0.95
R8514:Ubn1 UTSW 16 4,891,263 (GRCm39) missense probably damaging 1.00
R8559:Ubn1 UTSW 16 4,882,634 (GRCm39) missense possibly damaging 0.64
R8699:Ubn1 UTSW 16 4,881,567 (GRCm39) missense possibly damaging 0.79
R9350:Ubn1 UTSW 16 4,899,422 (GRCm39) missense probably benign 0.25
R9364:Ubn1 UTSW 16 4,888,492 (GRCm39) missense unknown
R9554:Ubn1 UTSW 16 4,888,492 (GRCm39) missense unknown
RF018:Ubn1 UTSW 16 4,882,256 (GRCm39) missense probably damaging 1.00
X0067:Ubn1 UTSW 16 4,873,202 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAGTAACCAGTCTCCCTCTTGC -3'
(R):5'- GCTGCCTGAATTCCTGATCC -3'

Sequencing Primer
(F):5'- GCCCTCAATGCCAGTAAGGAG -3'
(R):5'- GCCTGAATTCCTGATCCAATCC -3'
Posted On 2018-10-18