Incidental Mutation 'R6823:Diaph1'
ID 537778
Institutional Source Beutler Lab
Gene Symbol Diaph1
Ensembl Gene ENSMUSG00000024456
Gene Name diaphanous related formin 1
Synonyms Drf1, Dia1, D18Wsu154e, mDia1, Diap1, p140mDia
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6823 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 37843601-37935476 bp(-) (GRCm38)
Type of Mutation splice site (13315 bp from exon)
DNA Base Change (assembly) T to A at 37876383 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025337] [ENSMUST00000080033] [ENSMUST00000115629] [ENSMUST00000115631] [ENSMUST00000115634]
AlphaFold O08808
Predicted Effect probably benign
Transcript: ENSMUST00000025337
SMART Domains Protein: ENSMUSP00000025337
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 84 268 1.07e-57 SMART
Drf_FH3 274 466 2.06e-68 SMART
coiled coil region 471 571 N/A INTRINSIC
Pfam:Drf_FH1 609 756 6.1e-43 PFAM
FH2 761 1206 2.46e-182 SMART
Predicted Effect probably null
Transcript: ENSMUST00000080033
SMART Domains Protein: ENSMUSP00000078942
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 7.9e-52 PFAM
FH2 752 1197 3.73e-182 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115629
SMART Domains Protein: ENSMUSP00000111292
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 7.6e-52 PFAM
FH2 717 1162 3.73e-182 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115631
SMART Domains Protein: ENSMUSP00000111294
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 1.1e-51 PFAM
FH2 717 1162 2.46e-182 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115634
SMART Domains Protein: ENSMUSP00000111297
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 9.4e-52 PFAM
FH2 752 1197 2.46e-182 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: This gene encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myeloproliferative syndrome and myelodysplastic syndromes. Trafficking of T lymphocytes to secondary lymphoid organs and egression of thymocytes from the thymus are impaired in these animals. Lack of the encoded protein in T lymphocytes and thymocytes also reduces chemotaxis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hematopoiesis, bone marrow cell morphology, spleen morphology, skin physiology, skull morphology, and postnatal growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,754,886 probably null Het
Adgrv1 A G 13: 81,557,081 F1537L probably damaging Het
Aggf1 T C 13: 95,364,723 S384G probably benign Het
Anxa8 A T 14: 34,094,765 D204V possibly damaging Het
Asap3 A T 4: 136,227,572 E71V possibly damaging Het
BC024139 T C 15: 76,119,746 *773W probably null Het
Bckdhb T C 9: 83,953,761 V106A possibly damaging Het
Cep250 A G 2: 155,981,459 D1010G probably benign Het
Chrd T A 16: 20,734,736 L243Q probably damaging Het
Cib2 G T 9: 54,549,891 L30I possibly damaging Het
Cpsf7 T A 19: 10,532,884 L113* probably null Het
Cubn T A 2: 13,445,029 I895L probably benign Het
Cyp24a1 C A 2: 170,487,979 R351I probably benign Het
Cyp2a12 A T 7: 27,034,156 D320V possibly damaging Het
Dact1 C G 12: 71,317,939 P498R probably benign Het
Dnah7a A T 1: 53,456,704 I3198N probably benign Het
Dopey2 A T 16: 93,755,485 I271F possibly damaging Het
Erich3 C A 3: 154,727,437 F349L probably damaging Het
Fam187b G C 7: 30,989,290 V358L probably benign Het
Fat4 T A 3: 38,983,939 H3913Q probably benign Het
Fbxw7 G C 3: 84,958,627 E118D probably benign Het
Fgf1 A G 18: 38,847,108 I71T probably damaging Het
Fryl A T 5: 73,065,217 I2007K probably damaging Het
Galnt2 C G 8: 124,324,011 P130A probably benign Het
H1fx G A 6: 87,981,302 R19C probably damaging Het
Hmga2 A C 10: 120,476,024 S14A possibly damaging Het
Hoxb4 C T 11: 96,318,654 probably benign Het
Hr A T 14: 70,565,374 I756F probably damaging Het
Hrasls5 A T 19: 7,639,496 probably benign Het
Hspa1b A T 17: 34,958,185 S275T probably benign Het
Ikbkap A G 4: 56,787,939 Y331H probably damaging Het
Kcnh1 T C 1: 192,505,289 *99R probably null Het
Kit C A 5: 75,652,649 L864I probably benign Het
Klk14 A T 7: 43,694,456 K196* probably null Het
Lmod1 A G 1: 135,325,167 N53S probably damaging Het
Myh13 T C 11: 67,356,158 M1235T probably benign Het
Neurl3 T A 1: 36,268,704 K175* probably null Het
Nlgn2 T A 11: 69,825,924 K597M probably damaging Het
Npdc1 T C 2: 25,409,109 M306T probably damaging Het
Obscn C T 11: 59,067,943 probably null Het
Olfr404-ps1 T C 11: 74,239,696 L44P probably damaging Het
Olfr553 G A 7: 102,614,486 L168F probably damaging Het
Olfr913 T C 9: 38,594,905 I228T possibly damaging Het
Pbrm1 A T 14: 31,084,790 Y1042F probably damaging Het
Pclo T A 5: 14,677,907 probably benign Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Phf12 C T 11: 78,022,511 Q430* probably null Het
Pld3 C T 7: 27,535,897 R302H probably damaging Het
Plekha5 T C 6: 140,525,858 S112P probably benign Het
Pmfbp1 T A 8: 109,530,307 S548T possibly damaging Het
Ppa1 A T 10: 61,667,603 I220F probably damaging Het
Ppp2r3d A G 9: 124,439,078 probably benign Het
Psmg2 A T 18: 67,648,857 E164D possibly damaging Het
Rarb T C 14: 16,443,824 R155G probably damaging Het
Rnf215 T C 11: 4,136,609 L162S probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Rtkn2 G A 10: 68,026,632 V330M probably damaging Het
Slc16a4 A T 3: 107,311,498 I472F probably benign Het
Snx14 T C 9: 88,394,382 N617D possibly damaging Het
Spire2 T C 8: 123,356,727 V150A probably damaging Het
Sptbn1 C A 11: 30,114,787 R1904M probably damaging Het
Swap70 A G 7: 110,281,303 E575G possibly damaging Het
Tbxas1 A T 6: 38,919,153 M1L possibly damaging Het
Tenm3 A T 8: 48,256,837 V1688D probably damaging Het
Tgfbr3 A T 5: 107,149,914 S207T probably damaging Het
Timm44 A G 8: 4,267,282 F248L probably damaging Het
Tmem161a T C 8: 70,181,199 L170P probably damaging Het
Tmem63a A T 1: 180,960,470 Y263F possibly damaging Het
Tnfsf9 C A 17: 57,105,513 L28I probably benign Het
Tph2 T A 10: 115,174,106 N183I probably benign Het
Ttyh1 T C 7: 4,122,529 I60T probably damaging Het
Ubn1 T G 16: 5,064,547 S48A probably damaging Het
Ubr5 T C 15: 37,989,598 N2019S probably benign Het
Wbp2 T C 11: 116,086,910 N6D probably benign Het
Wdr59 T A 8: 111,459,040 E810V possibly damaging Het
Wiz T C 17: 32,360,421 D220G probably damaging Het
Yipf7 A G 5: 69,517,070 L244P probably damaging Het
Zdhhc17 T C 10: 110,955,111 T366A possibly damaging Het
Zfp169 A T 13: 48,490,996 probably benign Het
Zfp707 C T 15: 75,969,723 probably benign Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Diaph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Diaph1 APN 18 37893348 critical splice donor site probably null
IGL01432:Diaph1 APN 18 37897504 missense unknown
IGL01646:Diaph1 APN 18 37893416 critical splice acceptor site probably null
IGL01676:Diaph1 APN 18 37856188 nonsense probably null
IGL01731:Diaph1 APN 18 37853709 critical splice acceptor site probably benign
IGL01921:Diaph1 APN 18 37856208 missense possibly damaging 0.73
IGL02200:Diaph1 APN 18 37890682 missense unknown
IGL02258:Diaph1 APN 18 37853330 missense probably damaging 0.99
IGL02325:Diaph1 APN 18 37853600 missense probably damaging 1.00
IGL03304:Diaph1 APN 18 37854573 missense possibly damaging 0.47
albatross UTSW 18 37853679 nonsense probably null
cucamonga UTSW 18 37896093 critical splice donor site probably null
damselfly UTSW 18 37897550 nonsense probably null
devastator UTSW 18 37896093 critical splice donor site probably null
fishnets UTSW 18 37895300 critical splice acceptor site probably null
Guangzhou UTSW 18 37896093 critical splice donor site probably null
seethrough UTSW 18 37889769 missense probably damaging 1.00
sheer UTSW 18 37896093 critical splice donor site probably benign
R0137:Diaph1 UTSW 18 37891849 missense unknown
R0446:Diaph1 UTSW 18 37853590 missense possibly damaging 0.94
R0523:Diaph1 UTSW 18 37856500 missense possibly damaging 0.56
R1433:Diaph1 UTSW 18 37905134 missense unknown
R1532:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1534:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1535:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1536:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1537:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1611:Diaph1 UTSW 18 37900702 missense unknown
R1756:Diaph1 UTSW 18 37854573 missense possibly damaging 0.47
R1771:Diaph1 UTSW 18 37891018 missense unknown
R1812:Diaph1 UTSW 18 37891018 missense unknown
R2121:Diaph1 UTSW 18 37896389 missense unknown
R3710:Diaph1 UTSW 18 37845484 missense probably damaging 1.00
R3891:Diaph1 UTSW 18 37900638 splice site probably benign
R3892:Diaph1 UTSW 18 37900638 splice site probably benign
R4077:Diaph1 UTSW 18 37853583 missense possibly damaging 0.68
R4079:Diaph1 UTSW 18 37853583 missense possibly damaging 0.68
R4771:Diaph1 UTSW 18 37853551 missense probably damaging 1.00
R4815:Diaph1 UTSW 18 37895203 missense unknown
R5242:Diaph1 UTSW 18 37851635 missense probably damaging 1.00
R5294:Diaph1 UTSW 18 37897550 nonsense probably null
R5294:Diaph1 UTSW 18 37897580 missense unknown
R5349:Diaph1 UTSW 18 37891072 missense unknown
R5427:Diaph1 UTSW 18 37890595 missense unknown
R5623:Diaph1 UTSW 18 37896093 critical splice donor site probably benign
R5677:Diaph1 UTSW 18 37855951 missense probably damaging 1.00
R5730:Diaph1 UTSW 18 37903776 missense unknown
R5767:Diaph1 UTSW 18 37853355 missense probably damaging 1.00
R5925:Diaph1 UTSW 18 37891935 missense unknown
R6151:Diaph1 UTSW 18 37853353 missense probably damaging 1.00
R6876:Diaph1 UTSW 18 37896373 missense unknown
R6925:Diaph1 UTSW 18 37853679 nonsense probably null
R6983:Diaph1 UTSW 18 37889769 missense probably damaging 1.00
R7073:Diaph1 UTSW 18 37889814 critical splice acceptor site probably null
R7248:Diaph1 UTSW 18 37889776 missense probably benign 0.26
R7400:Diaph1 UTSW 18 37854502 missense probably damaging 1.00
R7497:Diaph1 UTSW 18 37895300 critical splice acceptor site probably null
R7544:Diaph1 UTSW 18 37893269 splice site probably null
R7703:Diaph1 UTSW 18 37890809 missense unknown
R7834:Diaph1 UTSW 18 37853709 critical splice acceptor site probably benign
R8073:Diaph1 UTSW 18 37891797 missense unknown
R8378:Diaph1 UTSW 18 37891953 missense unknown
R8847:Diaph1 UTSW 18 37854537 missense possibly damaging 0.71
R8947:Diaph1 UTSW 18 37853701 missense probably damaging 1.00
R8990:Diaph1 UTSW 18 37855804 missense probably damaging 1.00
R9059:Diaph1 UTSW 18 37889745 missense possibly damaging 0.53
R9189:Diaph1 UTSW 18 37891109 missense unknown
R9297:Diaph1 UTSW 18 37889775 missense probably benign 0.26
R9438:Diaph1 UTSW 18 37893390 missense unknown
R9439:Diaph1 UTSW 18 37896359 critical splice donor site probably null
R9538:Diaph1 UTSW 18 37853417 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAAGCTTAAAAGGCCTGATTG -3'
(R):5'- GCCTACAAACTGTAGTTGGTTAG -3'

Sequencing Primer
(F):5'- AAAGATGTGGTTCATATCACTGTGGC -3'
(R):5'- AACTGTAGTTGGTTAGTAGATGTAGG -3'
Posted On 2018-10-18