Incidental Mutation 'R6859:Nck2'
List |< first << previous [record 23 of 43] next >> last >|
ID537784
Institutional Source Beutler Lab
Gene Symbol Nck2
Ensembl Gene ENSMUSG00000066877
Gene Namenon-catalytic region of tyrosine kinase adaptor protein 2
Synonyms4833426I10Rik, Grb4, NCKbeta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6859 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location43444579-43570515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 43554351 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 239 (N239K)
Ref Sequence ENSEMBL: ENSMUSP00000083611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086421] [ENSMUST00000202540]
Predicted Effect probably benign
Transcript: ENSMUST00000086421
AA Change: N239K

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000083611
Gene: ENSMUSG00000066877
AA Change: N239K

DomainStartEndE-ValueType
SH3 5 60 7.06e-17 SMART
SH3 114 169 8.56e-16 SMART
SH3 198 256 2.09e-19 SMART
SH2 283 365 2.86e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114744
SMART Domains Protein: ENSMUSP00000110392
Gene: ENSMUSG00000066877

DomainStartEndE-ValueType
SH3 5 60 7.06e-17 SMART
SH3 114 169 8.56e-16 SMART
SH3 198 256 2.09e-19 SMART
SH2 283 365 2.86e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202540
SMART Domains Protein: ENSMUSP00000144224
Gene: ENSMUSG00000066877

DomainStartEndE-ValueType
SH3 5 60 4.3e-19 SMART
PDB:2CUB|A 106 142 4e-13 PDB
Blast:SH3 114 142 3e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NCK family of adaptor proteins. The protein contains three SH3 domains and one SH2 domain. The protein has no known catalytic function but has been shown to bind and recruit various proteins involved in the regulation of receptor protein tyrosine kinases. It is through these regulatory activities that this protein is believed to be involved in cytoskeletal reorganization. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene display no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,935 V788A possibly damaging Het
Abca15 A T 7: 120,402,994 K1577* probably null Het
Arhgap12 T C 18: 6,111,803 E187G probably damaging Het
Arhgef10 T A 8: 14,975,005 Y398N probably damaging Het
Baz2b C T 2: 59,901,530 V2055I probably benign Het
Btnl4 T C 17: 34,469,379 D475G probably damaging Het
C1qtnf12 T A 4: 155,965,613 F190Y probably damaging Het
Cacul1 A G 19: 60,534,245 S284P probably damaging Het
Ccdc166 C A 15: 75,981,971 V87L possibly damaging Het
Ceacam13 C T 7: 18,013,107 P162S probably damaging Het
Cep250 T A 2: 155,992,526 S2124T probably benign Het
Chd5 T C 4: 152,378,207 S1372P probably damaging Het
Chil3 C A 3: 106,160,414 R145L probably benign Het
Cyp4f40 T C 17: 32,675,949 S454P probably benign Het
Defa3 T A 8: 21,288,197 C66S probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Glmp C A 3: 88,328,042 N260K probably benign Het
Gsap T A 5: 21,281,018 L653Q probably damaging Het
Il18rap T A 1: 40,525,095 Y124* probably null Het
Lao1 A C 4: 118,963,751 K58T probably damaging Het
Lepr T A 4: 101,765,290 probably null Het
Mrgpra3 G C 7: 47,590,033 I48M probably benign Het
Olfr1208 A G 2: 88,896,934 I221T probably benign Het
Olfr360 A T 2: 37,068,782 Y159F probably damaging Het
Olfr65 G A 7: 103,906,701 W84* probably null Het
Optc A T 1: 133,897,816 V324E possibly damaging Het
Otog T C 7: 46,273,781 S1027P probably damaging Het
Plbd2 A G 5: 120,503,342 F84L probably benign Het
Plxnb1 T C 9: 109,106,770 L110P probably damaging Het
Prnp T C 2: 131,936,788 V120A possibly damaging Het
Ptprh C A 7: 4,549,371 E965* probably null Het
Reln T C 5: 22,034,570 T900A probably damaging Het
Stt3a A G 9: 36,735,386 Y644H probably damaging Het
Sulf2 A G 2: 166,087,119 Y311H probably damaging Het
Tbc1d32 A T 10: 56,180,530 I438N probably damaging Het
Tbcd T C 11: 121,497,111 V356A possibly damaging Het
Tecta T C 9: 42,392,129 N69S probably damaging Het
Topaz1 T C 9: 122,801,958 V1618A probably benign Het
Usp48 C T 4: 137,625,276 T627I possibly damaging Het
Vcl T C 14: 20,987,075 V247A probably damaging Het
Vmn2r59 A G 7: 42,043,853 L441P probably damaging Het
Zfp869 C T 8: 69,706,525 G466D probably damaging Het
Other mutations in Nck2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0420:Nck2 UTSW 1 43554118 missense probably damaging 1.00
R0503:Nck2 UTSW 1 43533568 start codon destroyed probably null 0.96
R0538:Nck2 UTSW 1 43569144 splice site probably benign
R1080:Nck2 UTSW 1 43533581 missense probably benign 0.00
R2509:Nck2 UTSW 1 43554233 missense probably damaging 1.00
R4029:Nck2 UTSW 1 43554091 missense probably benign
R4923:Nck2 UTSW 1 43461071 intron probably benign
R5425:Nck2 UTSW 1 43554392 missense probably benign 0.05
R6175:Nck2 UTSW 1 43533569 start codon destroyed probably null 0.96
R6683:Nck2 UTSW 1 43569178 missense probably benign
R7514:Nck2 UTSW 1 43569221 missense probably benign 0.00
R8021:Nck2 UTSW 1 43554260 missense probably benign
Z1088:Nck2 UTSW 1 43554383 missense possibly damaging 0.55
Z1177:Nck2 UTSW 1 43554356 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTACGTTTTGGAGGAAGCGGAC -3'
(R):5'- GACTCGCTGTCCCTAATGAG -3'

Sequencing Primer
(F):5'- TTCCTGAGCCTACGTCGG -3'
(R):5'- TCATTGAGCGCACACTCG -3'
Posted On2018-10-18