Incidental Mutation 'R6859:Optc'
ID537785
Institutional Source Beutler Lab
Gene Symbol Optc
Ensembl Gene ENSMUSG00000010311
Gene Nameopticin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6859 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location133897199-133907999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 133897816 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 324 (V324E)
Ref Sequence ENSEMBL: ENSMUSP00000123262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124051] [ENSMUST00000149380] [ENSMUST00000153617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000124051
AA Change: V377E

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120568
Gene: ENSMUSG00000010311
AA Change: V377E

DomainStartEndE-ValueType
low complexity region 42 70 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
LRRNT 176 206 2.22e-2 SMART
LRR 200 224 3.55e1 SMART
LRR_TYP 225 248 6.78e-3 SMART
LRR 249 271 4.21e1 SMART
LRR 295 318 1.76e1 SMART
LRR 319 339 3.36e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126123
SMART Domains Protein: ENSMUSP00000117086
Gene: ENSMUSG00000010311

DomainStartEndE-ValueType
low complexity region 32 60 N/A INTRINSIC
low complexity region 68 78 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
LRRNT 166 196 2.22e-2 SMART
LRR 190 214 3.55e1 SMART
LRR_TYP 215 238 6.78e-3 SMART
LRR 239 261 4.21e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000149380
AA Change: V324E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115661
Gene: ENSMUSG00000010311
AA Change: V324E

DomainStartEndE-ValueType
low complexity region 42 70 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
LRR 173 195 1.22e1 SMART
LRR 196 218 4.21e1 SMART
LRR 242 265 1.76e1 SMART
LRR 266 286 3.36e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000153617
AA Change: V324E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123262
Gene: ENSMUSG00000010311
AA Change: V324E

DomainStartEndE-ValueType
low complexity region 42 70 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
LRR 173 195 1.22e1 SMART
LRR 196 218 4.21e1 SMART
LRR 242 265 1.76e1 SMART
LRR 266 286 3.36e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Opticin belongs to class III of the small leucine-rich repeat protein (SLRP) family. Members of this family are typically associated with the extracellular matrix. Opticin is present in significant quantities in the vitreous of the eye and also localizes to the cornea, iris, ciliary body, optic nerve, choroid, retina, and fetal liver. Opticin may noncovalently bind collagen fibrils and regulate fibril morphology, spacing, and organization. The opticin gene is mapped to a region of chromosome 1 that is associated with the inherited eye diseases age-related macular degeneration (AMD) and posterior column ataxia with retinosa pigmentosa (AXPC1). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased preretinal neovascularization in an oxygen-induced retinopathy model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,935 V788A possibly damaging Het
Abca15 A T 7: 120,402,994 K1577* probably null Het
Arhgap12 T C 18: 6,111,803 E187G probably damaging Het
Arhgef10 T A 8: 14,975,005 Y398N probably damaging Het
Baz2b C T 2: 59,901,530 V2055I probably benign Het
Btnl4 T C 17: 34,469,379 D475G probably damaging Het
C1qtnf12 T A 4: 155,965,613 F190Y probably damaging Het
Cacul1 A G 19: 60,534,245 S284P probably damaging Het
Ccdc166 C A 15: 75,981,971 V87L possibly damaging Het
Ceacam13 C T 7: 18,013,107 P162S probably damaging Het
Cep250 T A 2: 155,992,526 S2124T probably benign Het
Chd5 T C 4: 152,378,207 S1372P probably damaging Het
Chil3 C A 3: 106,160,414 R145L probably benign Het
Cyp4f40 T C 17: 32,675,949 S454P probably benign Het
Defa3 T A 8: 21,288,197 C66S probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Glmp C A 3: 88,328,042 N260K probably benign Het
Gsap T A 5: 21,281,018 L653Q probably damaging Het
Il18rap T A 1: 40,525,095 Y124* probably null Het
Lao1 A C 4: 118,963,751 K58T probably damaging Het
Lepr T A 4: 101,765,290 probably null Het
Mrgpra3 G C 7: 47,590,033 I48M probably benign Het
Nck2 T G 1: 43,554,351 N239K probably benign Het
Olfr1208 A G 2: 88,896,934 I221T probably benign Het
Olfr360 A T 2: 37,068,782 Y159F probably damaging Het
Olfr65 G A 7: 103,906,701 W84* probably null Het
Otog T C 7: 46,273,781 S1027P probably damaging Het
Plbd2 A G 5: 120,503,342 F84L probably benign Het
Plxnb1 T C 9: 109,106,770 L110P probably damaging Het
Prnp T C 2: 131,936,788 V120A possibly damaging Het
Ptprh C A 7: 4,549,371 E965* probably null Het
Reln T C 5: 22,034,570 T900A probably damaging Het
Stt3a A G 9: 36,735,386 Y644H probably damaging Het
Sulf2 A G 2: 166,087,119 Y311H probably damaging Het
Tbc1d32 A T 10: 56,180,530 I438N probably damaging Het
Tbcd T C 11: 121,497,111 V356A possibly damaging Het
Tecta T C 9: 42,392,129 N69S probably damaging Het
Topaz1 T C 9: 122,801,958 V1618A probably benign Het
Usp48 C T 4: 137,625,276 T627I possibly damaging Het
Vcl T C 14: 20,987,075 V247A probably damaging Het
Vmn2r59 A G 7: 42,043,853 L441P probably damaging Het
Zfp869 C T 8: 69,706,525 G466D probably damaging Het
Other mutations in Optc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Optc APN 1 133902108 missense probably damaging 1.00
IGL01900:Optc APN 1 133902129 missense possibly damaging 0.68
IGL01988:Optc APN 1 133906929 critical splice donor site probably null
IGL02070:Optc APN 1 133901176 missense probably damaging 1.00
IGL02859:Optc APN 1 133902061 missense probably damaging 1.00
IGL03166:Optc APN 1 133903792 splice site probably benign
R0826:Optc UTSW 1 133905155 missense probably benign 0.07
R1728:Optc UTSW 1 133903796 splice site probably null
R1728:Optc UTSW 1 133905170 missense probably benign
R1729:Optc UTSW 1 133903796 splice site probably null
R1729:Optc UTSW 1 133905170 missense probably benign
R1730:Optc UTSW 1 133903796 splice site probably null
R1730:Optc UTSW 1 133905170 missense probably benign
R1739:Optc UTSW 1 133903796 splice site probably null
R1739:Optc UTSW 1 133905170 missense probably benign
R1762:Optc UTSW 1 133903796 splice site probably null
R1762:Optc UTSW 1 133905170 missense probably benign
R1783:Optc UTSW 1 133903796 splice site probably null
R1783:Optc UTSW 1 133905170 missense probably benign
R1784:Optc UTSW 1 133903796 splice site probably null
R1784:Optc UTSW 1 133905170 missense probably benign
R1785:Optc UTSW 1 133903796 splice site probably null
R1785:Optc UTSW 1 133905170 missense probably benign
R2049:Optc UTSW 1 133903796 splice site probably null
R2130:Optc UTSW 1 133903796 splice site probably null
R2131:Optc UTSW 1 133903796 splice site probably null
R2133:Optc UTSW 1 133903796 splice site probably null
R2141:Optc UTSW 1 133903796 splice site probably null
R2142:Optc UTSW 1 133903796 splice site probably null
R3436:Optc UTSW 1 133897879 missense probably damaging 1.00
R3437:Optc UTSW 1 133897879 missense probably damaging 1.00
R3711:Optc UTSW 1 133905081 missense probably benign 0.15
R3902:Optc UTSW 1 133897963 missense probably benign 0.10
R3930:Optc UTSW 1 133901182 nonsense probably null
R4078:Optc UTSW 1 133898349 missense probably damaging 1.00
R4523:Optc UTSW 1 133903754 missense possibly damaging 0.94
R4672:Optc UTSW 1 133897817 missense possibly damaging 0.48
R5113:Optc UTSW 1 133900977 splice site probably benign
R5176:Optc UTSW 1 133902084 missense probably benign 0.00
R5530:Optc UTSW 1 133905090 missense probably benign 0.01
R5692:Optc UTSW 1 133900976 splice site probably benign
R5819:Optc UTSW 1 133897879 missense probably damaging 1.00
R6208:Optc UTSW 1 133904999 missense probably damaging 1.00
R6828:Optc UTSW 1 133897867 missense probably damaging 1.00
R6986:Optc UTSW 1 133897964 missense probably benign 0.00
R7349:Optc UTSW 1 133897879 missense probably damaging 1.00
R7754:Optc UTSW 1 133906992 missense possibly damaging 0.73
X0025:Optc UTSW 1 133897911 missense probably damaging 1.00
Z1177:Optc UTSW 1 133901085 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGCAAATTAAGTGGCTGAAGGC -3'
(R):5'- TGAGCCTTCAATGCGTGCTG -3'

Sequencing Primer
(F):5'- CTGAAGGCCCTGTCTGTCTG -3'
(R):5'- TGCTCCTTCCAGAATAACATGATCG -3'
Posted On2018-10-18