Incidental Mutation 'R6859:Prnp'
ID537789
Institutional Source Beutler Lab
Gene Symbol Prnp
Ensembl Gene ENSMUSG00000079037
Gene Nameprion protein
SynonymsPrPC, Sinc, Prn-i, PrP, CD230, Prn-p, PrPSc
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R6859 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location131909928-131938429 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131936788 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 120 (V120A)
Ref Sequence ENSEMBL: ENSMUSP00000088833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091288] [ENSMUST00000124100] [ENSMUST00000136783]
PDB Structure
PRION PROTEIN DOMAIN PRP(121-231) FROM MOUSE, NMR, 2 MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
mouse prion protein fragment 121-231 [SOLUTION NMR]
Mouse Prion Protein with mutation N174T [SOLUTION NMR]
mouse prion protein with mutations S170N and N174T [SOLUTION NMR]
Mouse Prion Protein (121-231) with Mutation S170N [SOLUTION NMR]
Mouse Prion Protein (121-231) with Mutations Y225A and Y226A [SOLUTION NMR]
Mouse Prion Protein (121-231) with Mutation V166A [SOLUTION NMR]
Mouse Prion Protein (121-231) with mutation D167S [SOLUTION NMR]
Mouse Prion Protein (121-231) with mutations D167S and N173K [SOLUTION NMR]
Mouse prion protein (121-231) containing the substitution Y169G [SOLUTION NMR]
>> 11 additional structures at PDB <<
Predicted Effect possibly damaging
Transcript: ENSMUST00000091288
AA Change: V120A

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088833
Gene: ENSMUSG00000079037
AA Change: V120A

DomainStartEndE-ValueType
PRP 23 241 7.26e-181 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124100
SMART Domains Protein: ENSMUSP00000116195
Gene: ENSMUSG00000098754

DomainStartEndE-ValueType
Pfam:Doppel 1 30 2.5e-22 PFAM
Pfam:Prion 64 179 4.4e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136783
SMART Domains Protein: ENSMUSP00000122345
Gene: ENSMUSG00000098754

DomainStartEndE-ValueType
Pfam:Doppel 1 30 2.5e-22 PFAM
Pfam:Prion 64 179 4.4e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane glycosylphosphatidylinositol-anchored glycoprotein that tends to aggregate into rod-like structures. The encoded protein contains a highly unstable region of five tandem octapeptide repeats. This gene is found on chromosome 20, approximately 20 kbp upstream of a gene which encodes a biochemically and structurally similar protein to the one encoded by this gene. Mutations in the repeat region as well as elsewhere in this gene have been associated with Creutzfeldt-Jakob disease, fatal familial insomnia, Gerstmann-Straussler disease, Huntington disease-like 1, and kuru. An overlapping open reading frame has been found for this gene that encodes a smaller, structurally unrelated protein, AltPrp. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mutations at this locus affect resistance to scrapie infection and spongiform encephalopathy and/or alter scrapie incubation time. Homozygous mutants also show impaired locomotor coordination and reduced mitochondria numbers with unusual morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,935 V788A possibly damaging Het
Abca15 A T 7: 120,402,994 K1577* probably null Het
Arhgap12 T C 18: 6,111,803 E187G probably damaging Het
Arhgef10 T A 8: 14,975,005 Y398N probably damaging Het
Baz2b C T 2: 59,901,530 V2055I probably benign Het
Btnl4 T C 17: 34,469,379 D475G probably damaging Het
C1qtnf12 T A 4: 155,965,613 F190Y probably damaging Het
Cacul1 A G 19: 60,534,245 S284P probably damaging Het
Ccdc166 C A 15: 75,981,971 V87L possibly damaging Het
Ceacam13 C T 7: 18,013,107 P162S probably damaging Het
Cep250 T A 2: 155,992,526 S2124T probably benign Het
Chd5 T C 4: 152,378,207 S1372P probably damaging Het
Chil3 C A 3: 106,160,414 R145L probably benign Het
Cyp4f40 T C 17: 32,675,949 S454P probably benign Het
Defa3 T A 8: 21,288,197 C66S probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Glmp C A 3: 88,328,042 N260K probably benign Het
Gsap T A 5: 21,281,018 L653Q probably damaging Het
Il18rap T A 1: 40,525,095 Y124* probably null Het
Lao1 A C 4: 118,963,751 K58T probably damaging Het
Lepr T A 4: 101,765,290 probably null Het
Mrgpra3 G C 7: 47,590,033 I48M probably benign Het
Nck2 T G 1: 43,554,351 N239K probably benign Het
Olfr1208 A G 2: 88,896,934 I221T probably benign Het
Olfr360 A T 2: 37,068,782 Y159F probably damaging Het
Olfr65 G A 7: 103,906,701 W84* probably null Het
Optc A T 1: 133,897,816 V324E possibly damaging Het
Otog T C 7: 46,273,781 S1027P probably damaging Het
Plbd2 A G 5: 120,503,342 F84L probably benign Het
Plxnb1 T C 9: 109,106,770 L110P probably damaging Het
Ptprh C A 7: 4,549,371 E965* probably null Het
Reln T C 5: 22,034,570 T900A probably damaging Het
Stt3a A G 9: 36,735,386 Y644H probably damaging Het
Sulf2 A G 2: 166,087,119 Y311H probably damaging Het
Tbc1d32 A T 10: 56,180,530 I438N probably damaging Het
Tbcd T C 11: 121,497,111 V356A possibly damaging Het
Tecta T C 9: 42,392,129 N69S probably damaging Het
Topaz1 T C 9: 122,801,958 V1618A probably benign Het
Usp48 C T 4: 137,625,276 T627I possibly damaging Het
Vcl T C 14: 20,987,075 V247A probably damaging Het
Vmn2r59 A G 7: 42,043,853 L441P probably damaging Het
Zfp869 C T 8: 69,706,525 G466D probably damaging Het
Other mutations in Prnp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Prnp APN 2 131937111 missense probably benign
IGL01081:Prnp APN 2 131936420 intron probably benign
IGL01820:Prnp APN 2 131937070 missense probably benign 0.05
R0837:Prnp UTSW 2 131936524 missense probably damaging 1.00
R2303:Prnp UTSW 2 131937126 missense probably benign 0.00
R5214:Prnp UTSW 2 131937004 missense probably damaging 1.00
R5562:Prnp UTSW 2 131937031 missense probably damaging 1.00
R7589:Prnp UTSW 2 131936866 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ACTATGTGGACTGATGTCGGC -3'
(R):5'- TCGTGCACGAAGTTGTTCTG -3'

Sequencing Primer
(F):5'- CTGATGTCGGCCTCTGCAAAAAG -3'
(R):5'- TGGTTGCTGTACTGATCCAC -3'
Posted On2018-10-18