Incidental Mutation 'R6859:Sulf2'
List |< first << previous [record 35 of 43] next >> last >|
ID537791
Institutional Source Beutler Lab
Gene Symbol Sulf2
Ensembl Gene ENSMUSG00000006800
Gene Namesulfatase 2
Synonyms2010004N24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R6859 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location166073089-166155663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 166087119 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 311 (Y311H)
Ref Sequence ENSEMBL: ENSMUSP00000154557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088086] [ENSMUST00000109249] [ENSMUST00000146497]
Predicted Effect probably damaging
Transcript: ENSMUST00000088086
AA Change: Y311H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085405
Gene: ENSMUSG00000006800
AA Change: Y311H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sulfatase 44 375 2.8e-50 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 669 5.6e-47 PFAM
low complexity region 702 720 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109249
AA Change: Y311H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104872
Gene: ENSMUSG00000006800
AA Change: Y311H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sulfatase 44 375 2.8e-50 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 532 670 1.3e-46 PFAM
low complexity region 702 720 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146497
AA Change: Y311H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate proteoglycans (HSPGs) act as coreceptors for numerous heparin-binding growth factors and cytokines and are involved in cell signaling. Heparan sulfate 6-O-endosulfatases, such as SULF2, selectively remove 6-O-sulfate groups from heparan sulfate. This activity modulates the effects of heparan sulfate by altering binding sites for signaling molecules (Dai et al., 2005 [PubMed 16192265]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous disruption of this gene may lead to a partially penetrant, strain-dependent phenotype of embryonic lethality, reduced postnatal body weight, lung abnormalities, brain malformations, and reduced fertility. Mice homozygous for a hypomorphic gene-trap allele display skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,935 V788A possibly damaging Het
Abca15 A T 7: 120,402,994 K1577* probably null Het
Arhgap12 T C 18: 6,111,803 E187G probably damaging Het
Arhgef10 T A 8: 14,975,005 Y398N probably damaging Het
Baz2b C T 2: 59,901,530 V2055I probably benign Het
Btnl4 T C 17: 34,469,379 D475G probably damaging Het
C1qtnf12 T A 4: 155,965,613 F190Y probably damaging Het
Cacul1 A G 19: 60,534,245 S284P probably damaging Het
Ccdc166 C A 15: 75,981,971 V87L possibly damaging Het
Ceacam13 C T 7: 18,013,107 P162S probably damaging Het
Cep250 T A 2: 155,992,526 S2124T probably benign Het
Chd5 T C 4: 152,378,207 S1372P probably damaging Het
Chil3 C A 3: 106,160,414 R145L probably benign Het
Cyp4f40 T C 17: 32,675,949 S454P probably benign Het
Defa3 T A 8: 21,288,197 C66S probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Glmp C A 3: 88,328,042 N260K probably benign Het
Gsap T A 5: 21,281,018 L653Q probably damaging Het
Il18rap T A 1: 40,525,095 Y124* probably null Het
Lao1 A C 4: 118,963,751 K58T probably damaging Het
Lepr T A 4: 101,765,290 probably null Het
Mrgpra3 G C 7: 47,590,033 I48M probably benign Het
Nck2 T G 1: 43,554,351 N239K probably benign Het
Olfr1208 A G 2: 88,896,934 I221T probably benign Het
Olfr360 A T 2: 37,068,782 Y159F probably damaging Het
Olfr65 G A 7: 103,906,701 W84* probably null Het
Optc A T 1: 133,897,816 V324E possibly damaging Het
Otog T C 7: 46,273,781 S1027P probably damaging Het
Plbd2 A G 5: 120,503,342 F84L probably benign Het
Plxnb1 T C 9: 109,106,770 L110P probably damaging Het
Prnp T C 2: 131,936,788 V120A possibly damaging Het
Ptprh C A 7: 4,549,371 E965* probably null Het
Reln T C 5: 22,034,570 T900A probably damaging Het
Stt3a A G 9: 36,735,386 Y644H probably damaging Het
Tbc1d32 A T 10: 56,180,530 I438N probably damaging Het
Tbcd T C 11: 121,497,111 V356A possibly damaging Het
Tecta T C 9: 42,392,129 N69S probably damaging Het
Topaz1 T C 9: 122,801,958 V1618A probably benign Het
Usp48 C T 4: 137,625,276 T627I possibly damaging Het
Vcl T C 14: 20,987,075 V247A probably damaging Het
Vmn2r59 A G 7: 42,043,853 L441P probably damaging Het
Zfp869 C T 8: 69,706,525 G466D probably damaging Het
Other mutations in Sulf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Sulf2 APN 2 166094492 missense possibly damaging 0.48
IGL01353:Sulf2 APN 2 166087095 missense probably damaging 1.00
IGL02427:Sulf2 APN 2 166089298 missense probably damaging 0.99
IGL02602:Sulf2 APN 2 166081300 missense probably benign 0.32
IGL02681:Sulf2 APN 2 166116985 missense probably benign 0.01
IGL03047:Sulf2 APN 2 166080894 splice site probably null
PIT4468001:Sulf2 UTSW 2 166080800 missense probably benign
R0029:Sulf2 UTSW 2 166116973 missense possibly damaging 0.46
R0029:Sulf2 UTSW 2 166116973 missense possibly damaging 0.46
R0233:Sulf2 UTSW 2 166085669 splice site probably benign
R0332:Sulf2 UTSW 2 166089199 missense probably benign 0.00
R0411:Sulf2 UTSW 2 166093516 missense probably damaging 1.00
R0599:Sulf2 UTSW 2 166083879 missense possibly damaging 0.53
R0694:Sulf2 UTSW 2 166085791 missense probably damaging 1.00
R1594:Sulf2 UTSW 2 166084447 splice site probably benign
R1710:Sulf2 UTSW 2 166079072 missense probably benign
R1725:Sulf2 UTSW 2 166081361 missense probably damaging 0.96
R1737:Sulf2 UTSW 2 166082678 missense probably benign 0.01
R1775:Sulf2 UTSW 2 166079612 missense probably benign 0.07
R2001:Sulf2 UTSW 2 166080853 missense probably benign 0.05
R2570:Sulf2 UTSW 2 166085801 missense probably benign 0.21
R4052:Sulf2 UTSW 2 166094590 missense probably damaging 1.00
R4357:Sulf2 UTSW 2 166077577 missense probably benign 0.01
R4613:Sulf2 UTSW 2 166132605 missense probably damaging 1.00
R4790:Sulf2 UTSW 2 166089295 missense probably damaging 1.00
R4858:Sulf2 UTSW 2 166081604 missense probably benign 0.00
R5033:Sulf2 UTSW 2 166081622 missense probably benign 0.01
R5692:Sulf2 UTSW 2 166081506 missense probably benign 0.03
R5695:Sulf2 UTSW 2 166132758 missense probably benign 0.03
R6504:Sulf2 UTSW 2 166083921 missense probably benign 0.00
R6816:Sulf2 UTSW 2 166082754 missense probably benign
R6873:Sulf2 UTSW 2 166089275 missense probably damaging 0.97
R7125:Sulf2 UTSW 2 166075528 nonsense probably null
R7329:Sulf2 UTSW 2 166117088 missense probably damaging 1.00
R7343:Sulf2 UTSW 2 166077616 missense possibly damaging 0.69
R7669:Sulf2 UTSW 2 166093596 missense possibly damaging 0.67
R7833:Sulf2 UTSW 2 166079536 missense possibly damaging 0.92
R7916:Sulf2 UTSW 2 166079536 missense possibly damaging 0.92
RF016:Sulf2 UTSW 2 166082603 missense probably benign 0.01
X0063:Sulf2 UTSW 2 166079133 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGAATCTTGCCCCTGAGAGGC -3'
(R):5'- ATAAGGGAGTCAGTTCCGGG -3'

Sequencing Primer
(F):5'- TGAGTTTCAGACCAAGCAGAGTCC -3'
(R):5'- GGGCCTTGCAGAGAAGTG -3'
Posted On2018-10-18