Incidental Mutation 'R6859:Chil3'
List |< first << previous [record 13 of 43] next >> last >|
ID537793
Institutional Source Beutler Lab
Gene Symbol Chil3
Ensembl Gene ENSMUSG00000040809
Gene Namechitinase-like 3
SynonymsYm1, Chi3l3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R6859 (G1)
Quality Score195.009
Status Validated
Chromosome3
Chromosomal Location106147554-106167564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 106160414 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 145 (R145L)
Ref Sequence ENSEMBL: ENSMUSP00000053923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063062]
PDB Structure
THE CRYSTAL STRUCTURE OF NOVEL MAMMALIAN LECTIN YM1 SUGGESTS A SACCHARIDE BINDING SITE [X-RAY DIFFRACTION]
The Crystal Structure of Ym1 at 1.31 A Resolution [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000063062
AA Change: R145L

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000053923
Gene: ENSMUSG00000040809
AA Change: R145L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 5.17e-134 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: The protein encoded by this gene is similar to bacterial chitinases but lacks chitinase activity. The encoded protein is thought to function as a lectin and may be involved in inflammation and allergy. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,935 V788A possibly damaging Het
Abca15 A T 7: 120,402,994 K1577* probably null Het
Arhgap12 T C 18: 6,111,803 E187G probably damaging Het
Arhgef10 T A 8: 14,975,005 Y398N probably damaging Het
Baz2b C T 2: 59,901,530 V2055I probably benign Het
Btnl4 T C 17: 34,469,379 D475G probably damaging Het
C1qtnf12 T A 4: 155,965,613 F190Y probably damaging Het
Cacul1 A G 19: 60,534,245 S284P probably damaging Het
Ccdc166 C A 15: 75,981,971 V87L possibly damaging Het
Ceacam13 C T 7: 18,013,107 P162S probably damaging Het
Cep250 T A 2: 155,992,526 S2124T probably benign Het
Chd5 T C 4: 152,378,207 S1372P probably damaging Het
Cyp4f40 T C 17: 32,675,949 S454P probably benign Het
Defa3 T A 8: 21,288,197 C66S probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Glmp C A 3: 88,328,042 N260K probably benign Het
Gsap T A 5: 21,281,018 L653Q probably damaging Het
Il18rap T A 1: 40,525,095 Y124* probably null Het
Lao1 A C 4: 118,963,751 K58T probably damaging Het
Lepr T A 4: 101,765,290 probably null Het
Mrgpra3 G C 7: 47,590,033 I48M probably benign Het
Nck2 T G 1: 43,554,351 N239K probably benign Het
Olfr1208 A G 2: 88,896,934 I221T probably benign Het
Olfr360 A T 2: 37,068,782 Y159F probably damaging Het
Olfr65 G A 7: 103,906,701 W84* probably null Het
Optc A T 1: 133,897,816 V324E possibly damaging Het
Otog T C 7: 46,273,781 S1027P probably damaging Het
Plbd2 A G 5: 120,503,342 F84L probably benign Het
Plxnb1 T C 9: 109,106,770 L110P probably damaging Het
Prnp T C 2: 131,936,788 V120A possibly damaging Het
Ptprh C A 7: 4,549,371 E965* probably null Het
Reln T C 5: 22,034,570 T900A probably damaging Het
Stt3a A G 9: 36,735,386 Y644H probably damaging Het
Sulf2 A G 2: 166,087,119 Y311H probably damaging Het
Tbc1d32 A T 10: 56,180,530 I438N probably damaging Het
Tbcd T C 11: 121,497,111 V356A possibly damaging Het
Tecta T C 9: 42,392,129 N69S probably damaging Het
Topaz1 T C 9: 122,801,958 V1618A probably benign Het
Usp48 C T 4: 137,625,276 T627I possibly damaging Het
Vcl T C 14: 20,987,075 V247A probably damaging Het
Vmn2r59 A G 7: 42,043,853 L441P probably damaging Het
Zfp869 C T 8: 69,706,525 G466D probably damaging Het
Other mutations in Chil3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Chil3 APN 3 106148701 missense probably damaging 1.00
IGL01552:Chil3 APN 3 106148848 missense probably damaging 0.98
IGL02538:Chil3 APN 3 106164129 missense probably damaging 1.00
PIT4382001:Chil3 UTSW 3 106148659 missense probably damaging 1.00
R0145:Chil3 UTSW 3 106160478 missense probably damaging 1.00
R0269:Chil3 UTSW 3 106155756 missense probably benign 0.00
R0310:Chil3 UTSW 3 106160523 missense possibly damaging 0.75
R0453:Chil3 UTSW 3 106148905 missense probably benign 0.26
R0541:Chil3 UTSW 3 106161232 critical splice acceptor site probably null
R0617:Chil3 UTSW 3 106155756 missense probably benign 0.00
R0831:Chil3 UTSW 3 106149747 missense probably benign 0.19
R1699:Chil3 UTSW 3 106160366 critical splice donor site probably null
R1851:Chil3 UTSW 3 106148801 critical splice donor site probably null
R1852:Chil3 UTSW 3 106148801 critical splice donor site probably null
R2105:Chil3 UTSW 3 106160478 missense possibly damaging 0.73
R2202:Chil3 UTSW 3 106164246 missense probably benign 0.11
R2204:Chil3 UTSW 3 106164246 missense probably benign 0.11
R2205:Chil3 UTSW 3 106164246 missense probably benign 0.11
R4358:Chil3 UTSW 3 106160499 nonsense probably null
R4492:Chil3 UTSW 3 106155701 missense probably damaging 1.00
R4543:Chil3 UTSW 3 106160370 missense probably benign
R4554:Chil3 UTSW 3 106160370 missense probably benign
R4930:Chil3 UTSW 3 106164208 missense possibly damaging 0.67
R5011:Chil3 UTSW 3 106150161 missense possibly damaging 0.46
R5083:Chil3 UTSW 3 106164089 critical splice donor site probably null
R5231:Chil3 UTSW 3 106155729 missense probably damaging 0.96
R5423:Chil3 UTSW 3 106148662 missense probably damaging 1.00
R6804:Chil3 UTSW 3 106164179 nonsense probably null
R7218:Chil3 UTSW 3 106160537 splice site probably null
R7391:Chil3 UTSW 3 106164180 missense probably damaging 1.00
R7426:Chil3 UTSW 3 106155706 missense probably benign 0.05
R7582:Chil3 UTSW 3 106164256 missense probably damaging 1.00
R7620:Chil3 UTSW 3 106160435 missense probably damaging 1.00
R7647:Chil3 UTSW 3 106148806 missense possibly damaging 0.73
R7749:Chil3 UTSW 3 106148845 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ACTGTGGTTCTAACACAGCATAG -3'
(R):5'- GCCCAAGGTGTCCATGTCATAG -3'

Sequencing Primer
(F):5'- CAGCATAGAAAGTAATGTCTCACATG -3'
(R):5'- CCAAGGTGTCCATGTCATAGAAGTC -3'
Posted On2018-10-18