Incidental Mutation 'R6859:Lao1'
List |< first << previous [record 20 of 43] next >> last >|
ID537795
Institutional Source Beutler Lab
Gene Symbol Lao1
Ensembl Gene ENSMUSG00000024903
Gene NameL-amino acid oxidase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6859 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location118961578-118968912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 118963751 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 58 (K58T)
Ref Sequence ENSEMBL: ENSMUSP00000062834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058651]
Predicted Effect probably damaging
Transcript: ENSMUST00000058651
AA Change: K58T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062834
Gene: ENSMUSG00000024903
AA Change: K58T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pyr_redox_2 39 133 1.9e-8 PFAM
Pfam:HI0933_like 58 98 2.2e-7 PFAM
Pfam:FAD_binding_2 59 99 2.2e-7 PFAM
Pfam:Pyr_redox 59 106 5.4e-7 PFAM
Pfam:NAD_binding_8 62 129 8.1e-15 PFAM
Pfam:Amino_oxidase 67 509 3.1e-76 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show alterations in the free amino acid composition and antibacterial activity of milk and increased susceptibility to intramammary bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,935 V788A possibly damaging Het
Abca15 A T 7: 120,402,994 K1577* probably null Het
Arhgap12 T C 18: 6,111,803 E187G probably damaging Het
Arhgef10 T A 8: 14,975,005 Y398N probably damaging Het
Baz2b C T 2: 59,901,530 V2055I probably benign Het
Btnl4 T C 17: 34,469,379 D475G probably damaging Het
C1qtnf12 T A 4: 155,965,613 F190Y probably damaging Het
Cacul1 A G 19: 60,534,245 S284P probably damaging Het
Ccdc166 C A 15: 75,981,971 V87L possibly damaging Het
Ceacam13 C T 7: 18,013,107 P162S probably damaging Het
Cep250 T A 2: 155,992,526 S2124T probably benign Het
Chd5 T C 4: 152,378,207 S1372P probably damaging Het
Chil3 C A 3: 106,160,414 R145L probably benign Het
Cyp4f40 T C 17: 32,675,949 S454P probably benign Het
Defa3 T A 8: 21,288,197 C66S probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Glmp C A 3: 88,328,042 N260K probably benign Het
Gsap T A 5: 21,281,018 L653Q probably damaging Het
Il18rap T A 1: 40,525,095 Y124* probably null Het
Lepr T A 4: 101,765,290 probably null Het
Mrgpra3 G C 7: 47,590,033 I48M probably benign Het
Nck2 T G 1: 43,554,351 N239K probably benign Het
Olfr1208 A G 2: 88,896,934 I221T probably benign Het
Olfr360 A T 2: 37,068,782 Y159F probably damaging Het
Olfr65 G A 7: 103,906,701 W84* probably null Het
Optc A T 1: 133,897,816 V324E possibly damaging Het
Otog T C 7: 46,273,781 S1027P probably damaging Het
Plbd2 A G 5: 120,503,342 F84L probably benign Het
Plxnb1 T C 9: 109,106,770 L110P probably damaging Het
Prnp T C 2: 131,936,788 V120A possibly damaging Het
Ptprh C A 7: 4,549,371 E965* probably null Het
Reln T C 5: 22,034,570 T900A probably damaging Het
Stt3a A G 9: 36,735,386 Y644H probably damaging Het
Sulf2 A G 2: 166,087,119 Y311H probably damaging Het
Tbc1d32 A T 10: 56,180,530 I438N probably damaging Het
Tbcd T C 11: 121,497,111 V356A possibly damaging Het
Tecta T C 9: 42,392,129 N69S probably damaging Het
Topaz1 T C 9: 122,801,958 V1618A probably benign Het
Usp48 C T 4: 137,625,276 T627I possibly damaging Het
Vcl T C 14: 20,987,075 V247A probably damaging Het
Vmn2r59 A G 7: 42,043,853 L441P probably damaging Het
Zfp869 C T 8: 69,706,525 G466D probably damaging Het
Other mutations in Lao1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Lao1 APN 4 118968443 missense probably damaging 0.97
IGL02252:Lao1 APN 4 118967416 missense probably benign 0.19
R0139:Lao1 UTSW 4 118964202 missense probably benign 0.06
R0541:Lao1 UTSW 4 118963802 missense probably benign 0.03
R0635:Lao1 UTSW 4 118968296 missense probably benign 0.04
R1164:Lao1 UTSW 4 118965405 missense probably benign 0.00
R4465:Lao1 UTSW 4 118965307 missense probably benign 0.10
R4767:Lao1 UTSW 4 118967988 missense probably damaging 1.00
R4950:Lao1 UTSW 4 118965375 missense probably damaging 1.00
R5061:Lao1 UTSW 4 118967476 missense probably benign 0.00
R5488:Lao1 UTSW 4 118967369 missense probably damaging 1.00
R5644:Lao1 UTSW 4 118965236 splice site probably null
R6176:Lao1 UTSW 4 118962000 start codon destroyed probably null 0.40
R6189:Lao1 UTSW 4 118967880 missense probably benign 0.00
R6857:Lao1 UTSW 4 118963826 critical splice donor site probably null
R7074:Lao1 UTSW 4 118968185 missense probably damaging 1.00
R7878:Lao1 UTSW 4 118967422 missense probably benign 0.00
R7961:Lao1 UTSW 4 118967422 missense probably benign 0.00
R8021:Lao1 UTSW 4 118968477 missense probably damaging 0.99
X0021:Lao1 UTSW 4 118968522 missense probably benign 0.00
Z1176:Lao1 UTSW 4 118968440 missense probably damaging 1.00
Z1177:Lao1 UTSW 4 118968371 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGAGGTCCTCATCTGACTG -3'
(R):5'- GCCGGTACACTCAATTGTGC -3'

Sequencing Primer
(F):5'- TTGGCTCAGGGAAGACCAC -3'
(R):5'- CACTCAATTGTGCATTGTCAGGCTAG -3'
Posted On2018-10-18