Mutagenetix > Incidental Mutations

Incidental Mutation 'R6859:Gsap'

537799

Institutional Source

Beutler Lab

Gene Symbol

Gsap

Ensembl Gene

ENSMUSG00000039934

Gene Name

gamma-secretase activating protein

Synonyms

A530088I07Rik, Pion

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.156) question?

Stock #

R6859 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21186255-21315132 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 21281018 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 653 (L653Q)

Ref Sequence

ENSEMBL: ENSMUSP00000043679 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036031] [ENSMUST00000195969] [ENSMUST00000198014] [ENSMUST00000198937]

Predicted Effect

probably damaging
Transcript: ENSMUST00000036031
AA Change: L653Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000043679
Gene: ENSMUSG00000039934
AA Change: L653Q

Domain	Start	End	E-Value	Type
low complexity region	386	398	N/A	INTRINSIC
Pfam:GSAP-16	646	753	6.8e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195969

Predicted Effect

probably benign
Transcript: ENSMUST00000198014

Predicted Effect

probably damaging
Transcript: ENSMUST00000198937
AA Change: L622Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000142986
Gene: ENSMUSG00000039934
AA Change: L622Q

Domain	Start	End	E-Value	Type
low complexity region	355	367	N/A	INTRINSIC
Pfam:GSAP-16	608	722	1.6e-42	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accumulation of neurotoxic amyloid-beta is a major hallmark of Alzheimer disease (AD; MIM 104300). Formation of amyloid-beta is catalyzed by gamma-secretase (see PSEN1; MIM 104311), a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, the amyloid-beta precursor protein (APP; MIM 104760) C-terminal fragment (APP-CTF) (He et al., 2010 [PubMed 20811458]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	T	C	16: 4,851,935	V788A	possibly damaging	Het
Abca15	A	T	7: 120,402,994	K1577*	probably null	Het
Arhgap12	T	C	18: 6,111,803	E187G	probably damaging	Het
Arhgef10	T	A	8: 14,975,005	Y398N	probably damaging	Het
Baz2b	C	T	2: 59,901,530	V2055I	probably benign	Het
Btnl4	T	C	17: 34,469,379	D475G	probably damaging	Het
C1qtnf12	T	A	4: 155,965,613	F190Y	probably damaging	Het
Cacul1	A	G	19: 60,534,245	S284P	probably damaging	Het
Ccdc166	C	A	15: 75,981,971	V87L	possibly damaging	Het
Ceacam13	C	T	7: 18,013,107	P162S	probably damaging	Het
Cep250	T	A	2: 155,992,526	S2124T	probably benign	Het
Chd5	T	C	4: 152,378,207	S1372P	probably damaging	Het
Chil3	C	A	3: 106,160,414	R145L	probably benign	Het
Cyp4f40	T	C	17: 32,675,949	S454P	probably benign	Het
Defa3	T	A	8: 21,288,197	C66S	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Glmp	C	A	3: 88,328,042	N260K	probably benign	Het
Il18rap	T	A	1: 40,525,095	Y124*	probably null	Het
Lao1	A	C	4: 118,963,751	K58T	probably damaging	Het
Lepr	T	A	4: 101,765,290		probably null	Het
Mrgpra3	G	C	7: 47,590,033	I48M	probably benign	Het
Nck2	T	G	1: 43,554,351	N239K	probably benign	Het
Olfr1208	A	G	2: 88,896,934	I221T	probably benign	Het
Olfr360	A	T	2: 37,068,782	Y159F	probably damaging	Het
Olfr65	G	A	7: 103,906,701	W84*	probably null	Het
Optc	A	T	1: 133,897,816	V324E	possibly damaging	Het
Otog	T	C	7: 46,273,781	S1027P	probably damaging	Het
Plbd2	A	G	5: 120,503,342	F84L	probably benign	Het
Plxnb1	T	C	9: 109,106,770	L110P	probably damaging	Het
Prnp	T	C	2: 131,936,788	V120A	possibly damaging	Het
Ptprh	C	A	7: 4,549,371	E965*	probably null	Het
Reln	T	C	5: 22,034,570	T900A	probably damaging	Het
Stt3a	A	G	9: 36,735,386	Y644H	probably damaging	Het
Sulf2	A	G	2: 166,087,119	Y311H	probably damaging	Het
Tbc1d32	A	T	10: 56,180,530	I438N	probably damaging	Het
Tbcd	T	C	11: 121,497,111	V356A	possibly damaging	Het
Tecta	T	C	9: 42,392,129	N69S	probably damaging	Het
Topaz1	T	C	9: 122,801,958	V1618A	probably benign	Het
Usp48	C	T	4: 137,625,276	T627I	possibly damaging	Het
Vcl	T	C	14: 20,987,075	V247A	probably damaging	Het
Vmn2r59	A	G	7: 42,043,853	L441P	probably damaging	Het
Zfp869	C	T	8: 69,706,525	G466D	probably damaging	Het

Other mutations in Gsap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00788:Gsap	APN	5	21221305	splice site	probably benign
IGL00788:Gsap	APN	5	21254024	missense	probably damaging	0.96
IGL01344:Gsap	APN	5	21242883	critical splice donor site	probably null
IGL01347:Gsap	APN	5	21226320	missense	probably benign	0.08
IGL01618:Gsap	APN	5	21226248	missense	probably damaging	1.00
IGL01730:Gsap	APN	5	21290154	unclassified	probably benign
IGL02061:Gsap	APN	5	21281611	splice site	probably benign
IGL02161:Gsap	APN	5	21253379	missense	probably damaging	1.00
IGL02259:Gsap	APN	5	21186400	missense	probably benign	0.01
IGL02635:Gsap	APN	5	21289816	missense	probably damaging	1.00
IGL02684:Gsap	APN	5	21242803	critical splice acceptor site	probably null
IGL02822:Gsap	APN	5	21217444	missense	probably damaging	1.00
IGL03231:Gsap	APN	5	21229166	missense	probably damaging	0.99
PIT4305001:Gsap	UTSW	5	21186409	missense	probably damaging	0.98
R0012:Gsap	UTSW	5	21226229	splice site	probably benign
R0012:Gsap	UTSW	5	21226229	splice site	probably benign
R0019:Gsap	UTSW	5	21270622	splice site	probably benign
R0019:Gsap	UTSW	5	21270622	splice site	probably benign
R0045:Gsap	UTSW	5	21226832	missense	possibly damaging	0.77
R0054:Gsap	UTSW	5	21250935	splice site	probably benign
R0054:Gsap	UTSW	5	21250935	splice site	probably benign
R0409:Gsap	UTSW	5	21222445	splice site	probably benign
R0507:Gsap	UTSW	5	21269963	missense	possibly damaging	0.75
R0624:Gsap	UTSW	5	21253951	splice site	probably null
R1037:Gsap	UTSW	5	21251165	splice site	probably benign
R1076:Gsap	UTSW	5	21287694	missense	possibly damaging	0.75
R1459:Gsap	UTSW	5	21207238	splice site	probably benign
R1757:Gsap	UTSW	5	21281037	missense	probably damaging	0.98
R1852:Gsap	UTSW	5	21290545	unclassified	probably null
R2034:Gsap	UTSW	5	21270595	missense	probably damaging	1.00
R2069:Gsap	UTSW	5	21226839	splice site	probably benign
R2125:Gsap	UTSW	5	21242813	missense	probably damaging	1.00
R2172:Gsap	UTSW	5	21222440	critical splice donor site	probably null
R2310:Gsap	UTSW	5	21196090	nonsense	probably null
R2337:Gsap	UTSW	5	21288630	missense	probably damaging	1.00
R3442:Gsap	UTSW	5	21278127	missense	probably damaging	1.00
R4229:Gsap	UTSW	5	21246977	missense	probably benign	0.00
R4271:Gsap	UTSW	5	21226350	critical splice donor site	probably null
R4551:Gsap	UTSW	5	21290571	missense	probably damaging	1.00
R4553:Gsap	UTSW	5	21290571	missense	probably damaging	1.00
R4649:Gsap	UTSW	5	21226311	missense	probably damaging	1.00
R4687:Gsap	UTSW	5	21246971	utr 3 prime	probably benign
R4799:Gsap	UTSW	5	21250943	missense	probably benign	0.05
R4857:Gsap	UTSW	5	21287799	splice site	probably null
R4973:Gsap	UTSW	5	21254039	missense	probably benign	0.04
R5015:Gsap	UTSW	5	21222408	missense	probably damaging	1.00
R5031:Gsap	UTSW	5	21242826	missense	possibly damaging	0.57
R5120:Gsap	UTSW	5	21269936	missense	probably damaging	0.96
R5451:Gsap	UTSW	5	21217447	missense	probably damaging	1.00
R5469:Gsap	UTSW	5	21290544	missense	possibly damaging	0.92
R5519:Gsap	UTSW	5	21289859	missense	probably damaging	1.00
R5588:Gsap	UTSW	5	21251149	missense	probably damaging	1.00
R5650:Gsap	UTSW	5	21251053	missense	probably damaging	0.99
R6064:Gsap	UTSW	5	21229225	missense	possibly damaging	0.56
R6139:Gsap	UTSW	5	21281540	missense	probably damaging	1.00
R6148:Gsap	UTSW	5	21226325	missense	probably damaging	1.00
R6148:Gsap	UTSW	5	21270577	missense	probably benign	0.39
R6226:Gsap	UTSW	5	21217431	missense	probably damaging	1.00
R6977:Gsap	UTSW	5	21271221	missense	probably damaging	1.00
R6995:Gsap	UTSW	5	21271237	missense	possibly damaging	0.58
R7013:Gsap	UTSW	5	21278110	missense	probably benign	0.39
R7159:Gsap	UTSW	5	21270620	splice site	probably null
R7181:Gsap	UTSW	5	21253429	missense	probably damaging	1.00
R7234:Gsap	UTSW	5	21186435	missense	probably benign
R7332:Gsap	UTSW	5	21290121	missense	probably benign	0.00
R7381:Gsap	UTSW	5	21226787	missense	probably damaging	0.96
R8047:Gsap	UTSW	5	21257868	critical splice acceptor site	probably null
R8062:Gsap	UTSW	5	21194463	missense	probably damaging	1.00
Z1177:Gsap	UTSW	5	21251032	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGAACTACTTTCAGAAAGGCTAGTTG -3'
(R):5'- AACCATGTGCCACAGAGGAC -3'

Sequencing Primer
(F):5'- AAAGGCTAGTTGTATAGTGGGCC -3'
(R):5'- GGACAGCTGAAGTAACCTGTAATTC -3'

Posted On

2018-10-18