Incidental Mutation 'R6859:Ceacam13'
ID537803
Institutional Source Beutler Lab
Gene Symbol Ceacam13
Ensembl Gene ENSMUSG00000057195
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 13
Synonyms1600025J19Rik, Ceacam13-C2, Ceacam13-C1, 1600012K03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6859 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location18009889-18019221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18013107 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 162 (P162S)
Ref Sequence ENSEMBL: ENSMUSP00000104128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081703] [ENSMUST00000108488]
Predicted Effect probably damaging
Transcript: ENSMUST00000081703
AA Change: P162S

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080404
Gene: ENSMUSG00000057195
AA Change: P162S

DomainStartEndE-ValueType
IG_like 40 143 1.37e1 SMART
IG_like 158 261 8.97e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108488
AA Change: P162S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104128
Gene: ENSMUSG00000057195
AA Change: P162S

DomainStartEndE-ValueType
IG_like 40 143 1.37e1 SMART
IG_like 158 261 8.97e0 SMART
Meta Mutation Damage Score 0.1540 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,935 V788A possibly damaging Het
Abca15 A T 7: 120,402,994 K1577* probably null Het
Arhgap12 T C 18: 6,111,803 E187G probably damaging Het
Arhgef10 T A 8: 14,975,005 Y398N probably damaging Het
Baz2b C T 2: 59,901,530 V2055I probably benign Het
Btnl4 T C 17: 34,469,379 D475G probably damaging Het
C1qtnf12 T A 4: 155,965,613 F190Y probably damaging Het
Cacul1 A G 19: 60,534,245 S284P probably damaging Het
Ccdc166 C A 15: 75,981,971 V87L possibly damaging Het
Cep250 T A 2: 155,992,526 S2124T probably benign Het
Chd5 T C 4: 152,378,207 S1372P probably damaging Het
Chil3 C A 3: 106,160,414 R145L probably benign Het
Cyp4f40 T C 17: 32,675,949 S454P probably benign Het
Defa3 T A 8: 21,288,197 C66S probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Glmp C A 3: 88,328,042 N260K probably benign Het
Gsap T A 5: 21,281,018 L653Q probably damaging Het
Il18rap T A 1: 40,525,095 Y124* probably null Het
Lao1 A C 4: 118,963,751 K58T probably damaging Het
Lepr T A 4: 101,765,290 probably null Het
Mrgpra3 G C 7: 47,590,033 I48M probably benign Het
Nck2 T G 1: 43,554,351 N239K probably benign Het
Olfr1208 A G 2: 88,896,934 I221T probably benign Het
Olfr360 A T 2: 37,068,782 Y159F probably damaging Het
Olfr65 G A 7: 103,906,701 W84* probably null Het
Optc A T 1: 133,897,816 V324E possibly damaging Het
Otog T C 7: 46,273,781 S1027P probably damaging Het
Plbd2 A G 5: 120,503,342 F84L probably benign Het
Plxnb1 T C 9: 109,106,770 L110P probably damaging Het
Prnp T C 2: 131,936,788 V120A possibly damaging Het
Ptprh C A 7: 4,549,371 E965* probably null Het
Reln T C 5: 22,034,570 T900A probably damaging Het
Stt3a A G 9: 36,735,386 Y644H probably damaging Het
Sulf2 A G 2: 166,087,119 Y311H probably damaging Het
Tbc1d32 A T 10: 56,180,530 I438N probably damaging Het
Tbcd T C 11: 121,497,111 V356A possibly damaging Het
Tecta T C 9: 42,392,129 N69S probably damaging Het
Topaz1 T C 9: 122,801,958 V1618A probably benign Het
Usp48 C T 4: 137,625,276 T627I possibly damaging Het
Vcl T C 14: 20,987,075 V247A probably damaging Het
Vmn2r59 A G 7: 42,043,853 L441P probably damaging Het
Zfp869 C T 8: 69,706,525 G466D probably damaging Het
Other mutations in Ceacam13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Ceacam13 APN 7 18013353 missense possibly damaging 0.59
IGL01617:Ceacam13 APN 7 18011383 missense possibly damaging 0.53
IGL02948:Ceacam13 APN 7 18011063 splice site probably benign
R1508:Ceacam13 UTSW 7 18011071 missense possibly damaging 0.89
R3794:Ceacam13 UTSW 7 18013415 makesense probably null
R4882:Ceacam13 UTSW 7 18013072 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AGGACTGATGGACACACCTG -3'
(R):5'- AGGGTATAAAGCCCTGCGTC -3'

Sequencing Primer
(F):5'- TGATGGACACACCTGCTCATG -3'
(R):5'- AGGACCCATCATTGCGTAC -3'
Posted On2018-10-18