Incidental Mutation 'R6859:Fan1'
List |< first << previous [record 16 of 43] next >> last >|
ID537807
Institutional Source Beutler Lab
Gene Symbol Fan1
Ensembl Gene ENSMUSG00000033458
Gene NameFANCD2/FANCI-associated nuclease 1
SynonymsMtmr15
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6859 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location64346758-64374095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64372486 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 340 (N340Y)
Ref Sequence ENSEMBL: ENSMUSP00000130012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032735] [ENSMUST00000163289]
Predicted Effect probably benign
Transcript: ENSMUST00000032735
SMART Domains Protein: ENSMUSP00000032735
Gene: ENSMUSG00000030521

DomainStartEndE-ValueType
Pfam:Mpp10 20 654 6.9e-217 PFAM
low complexity region 666 671 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163289
AA Change: N340Y

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130012
Gene: ENSMUSG00000033458
AA Change: N340Y

DomainStartEndE-ValueType
SCOP:d1ihga1 600 737 5e-5 SMART
Blast:VRR_NUC 834 867 2e-12 BLAST
VRR_NUC 896 1011 1.99e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206778
Meta Mutation Damage Score 0.1011 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene plays a role in DNA interstrand cross-link repair and encodes a protein with 5' flap endonuclease and 5'-3' exonuclease activity. Mutations in this gene cause karyomegalic interstitial nephritis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for mutations in this gene display renal tubular karyomegaly with polyploidy and defects in interstrand cross-link DNA repair. Some homozygous mice also display hepatocyte karyomegaly and liver dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,935 V788A possibly damaging Het
Abca15 A T 7: 120,402,994 K1577* probably null Het
Arhgap12 T C 18: 6,111,803 E187G probably damaging Het
Arhgef10 T A 8: 14,975,005 Y398N probably damaging Het
Baz2b C T 2: 59,901,530 V2055I probably benign Het
Btnl4 T C 17: 34,469,379 D475G probably damaging Het
C1qtnf12 T A 4: 155,965,613 F190Y probably damaging Het
Cacul1 A G 19: 60,534,245 S284P probably damaging Het
Ccdc166 C A 15: 75,981,971 V87L possibly damaging Het
Ceacam13 C T 7: 18,013,107 P162S probably damaging Het
Cep250 T A 2: 155,992,526 S2124T probably benign Het
Chd5 T C 4: 152,378,207 S1372P probably damaging Het
Chil3 C A 3: 106,160,414 R145L probably benign Het
Cyp4f40 T C 17: 32,675,949 S454P probably benign Het
Defa3 T A 8: 21,288,197 C66S probably damaging Het
Glmp C A 3: 88,328,042 N260K probably benign Het
Gsap T A 5: 21,281,018 L653Q probably damaging Het
Il18rap T A 1: 40,525,095 Y124* probably null Het
Lao1 A C 4: 118,963,751 K58T probably damaging Het
Lepr T A 4: 101,765,290 probably null Het
Mrgpra3 G C 7: 47,590,033 I48M probably benign Het
Nck2 T G 1: 43,554,351 N239K probably benign Het
Olfr1208 A G 2: 88,896,934 I221T probably benign Het
Olfr360 A T 2: 37,068,782 Y159F probably damaging Het
Olfr65 G A 7: 103,906,701 W84* probably null Het
Optc A T 1: 133,897,816 V324E possibly damaging Het
Otog T C 7: 46,273,781 S1027P probably damaging Het
Plbd2 A G 5: 120,503,342 F84L probably benign Het
Plxnb1 T C 9: 109,106,770 L110P probably damaging Het
Prnp T C 2: 131,936,788 V120A possibly damaging Het
Ptprh C A 7: 4,549,371 E965* probably null Het
Reln T C 5: 22,034,570 T900A probably damaging Het
Stt3a A G 9: 36,735,386 Y644H probably damaging Het
Sulf2 A G 2: 166,087,119 Y311H probably damaging Het
Tbc1d32 A T 10: 56,180,530 I438N probably damaging Het
Tbcd T C 11: 121,497,111 V356A possibly damaging Het
Tecta T C 9: 42,392,129 N69S probably damaging Het
Topaz1 T C 9: 122,801,958 V1618A probably benign Het
Usp48 C T 4: 137,625,276 T627I possibly damaging Het
Vcl T C 14: 20,987,075 V247A probably damaging Het
Vmn2r59 A G 7: 42,043,853 L441P probably damaging Het
Zfp869 C T 8: 69,706,525 G466D probably damaging Het
Other mutations in Fan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Fan1 APN 7 64372549 missense probably damaging 0.96
IGL01752:Fan1 APN 7 64372794 missense probably benign 0.00
IGL01971:Fan1 APN 7 64353711 missense probably damaging 0.98
IGL02043:Fan1 APN 7 64371619 unclassified probably null
IGL02542:Fan1 APN 7 64364660 missense probably damaging 1.00
IGL02731:Fan1 APN 7 64372993 missense possibly damaging 0.86
IGL03111:Fan1 APN 7 64350068 missense possibly damaging 0.67
hitched UTSW 7 64364629 missense probably damaging 1.00
stitched UTSW 7 64372486 missense probably damaging 0.97
R0270:Fan1 UTSW 7 64348871 missense probably benign 0.26
R0632:Fan1 UTSW 7 64363199 missense possibly damaging 0.50
R1714:Fan1 UTSW 7 64366687 missense probably benign 0.29
R1750:Fan1 UTSW 7 64373013 missense probably benign 0.14
R1822:Fan1 UTSW 7 64372806 missense probably benign 0.00
R2031:Fan1 UTSW 7 64354424 missense probably damaging 0.98
R2107:Fan1 UTSW 7 64366788 missense probably damaging 1.00
R2126:Fan1 UTSW 7 64346888 missense probably damaging 1.00
R2869:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2869:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2870:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2870:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2871:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2871:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2873:Fan1 UTSW 7 64363190 missense probably benign 0.16
R3849:Fan1 UTSW 7 64372371 missense probably damaging 1.00
R3850:Fan1 UTSW 7 64372371 missense probably damaging 1.00
R3949:Fan1 UTSW 7 64371544 nonsense probably null
R4007:Fan1 UTSW 7 64366561 missense probably damaging 1.00
R4490:Fan1 UTSW 7 64369180 missense possibly damaging 0.84
R4623:Fan1 UTSW 7 64373553 nonsense probably null
R4918:Fan1 UTSW 7 64373538 utr 5 prime probably benign
R5328:Fan1 UTSW 7 64354469 missense probably damaging 1.00
R5691:Fan1 UTSW 7 64354370 unclassified probably null
R5902:Fan1 UTSW 7 64373322 unclassified probably null
R5905:Fan1 UTSW 7 64353651 missense probably benign 0.00
R6126:Fan1 UTSW 7 64364570 nonsense probably null
R6195:Fan1 UTSW 7 64354371 missense probably damaging 1.00
R6233:Fan1 UTSW 7 64354371 missense probably damaging 1.00
R6405:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6434:Fan1 UTSW 7 64354381 missense probably damaging 0.99
R6460:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6469:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6471:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6473:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6696:Fan1 UTSW 7 64350078 missense probably damaging 1.00
R6708:Fan1 UTSW 7 64372806 missense probably benign 0.00
R6713:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6714:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6749:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6841:Fan1 UTSW 7 64364629 missense probably damaging 1.00
R6858:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6860:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6925:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6927:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6936:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6938:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6939:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7040:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7120:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7290:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7292:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7459:Fan1 UTSW 7 64348966 missense probably damaging 0.99
R7460:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7464:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7465:Fan1 UTSW 7 64353638 missense probably benign 0.30
R7465:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7608:Fan1 UTSW 7 64354231 intron probably null
R7624:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7629:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7682:Fan1 UTSW 7 64372764 missense probably benign 0.06
R7731:Fan1 UTSW 7 64372696 missense probably benign 0.17
R7863:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7946:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8054:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8055:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8057:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8058:Fan1 UTSW 7 64372486 missense probably damaging 0.97
X0025:Fan1 UTSW 7 64372835 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CGAAGAGCTTCATGTCCTCTTC -3'
(R):5'- TCAACTCTCGTCAGTAACACG -3'

Sequencing Primer
(F):5'- CTCTTCGTTCCCAAGGAGG -3'
(R):5'- TCTCCGGGAGACACTCTTGTAAAG -3'
Posted On2018-10-18