Incidental Mutation 'R6859:Zfp869'
List |< first << previous [record 43 of 43]
ID537812
Institutional Source Beutler Lab
Gene Symbol Zfp869
Ensembl Gene ENSMUSG00000054648
Gene Namezinc finger protein 869
SynonymsU 2-7-1, 1200003I07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R6859 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location69706332-69710724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69706525 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 466 (G466D)
Ref Sequence ENSEMBL: ENSMUSP00000079780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080987]
Predicted Effect probably damaging
Transcript: ENSMUST00000080987
AA Change: G466D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079780
Gene: ENSMUSG00000054648
AA Change: G466D

DomainStartEndE-ValueType
KRAB 16 73 6.16e-15 SMART
low complexity region 83 94 N/A INTRINSIC
ZnF_C2H2 180 202 3.44e-4 SMART
ZnF_C2H2 208 230 5.5e-3 SMART
ZnF_C2H2 236 258 9.08e-4 SMART
ZnF_C2H2 264 286 2.71e-2 SMART
ZnF_C2H2 292 314 2.09e-3 SMART
ZnF_C2H2 320 342 6.88e-4 SMART
ZnF_C2H2 348 370 1.25e-1 SMART
ZnF_C2H2 376 398 1.38e-3 SMART
ZnF_C2H2 404 426 5.14e-3 SMART
ZnF_C2H2 432 454 3.16e-3 SMART
ZnF_C2H2 460 482 3.69e-4 SMART
ZnF_C2H2 488 510 1.04e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ZNF91 gene encodes a zinc finger protein of the KRAB (Kruppel-associated box) subfamily (Bellefroid et al., 1991, 1993 [PubMed 2023909] [PubMed 8467795]).[supplied by OMIM, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,935 V788A possibly damaging Het
Abca15 A T 7: 120,402,994 K1577* probably null Het
Arhgap12 T C 18: 6,111,803 E187G probably damaging Het
Arhgef10 T A 8: 14,975,005 Y398N probably damaging Het
Baz2b C T 2: 59,901,530 V2055I probably benign Het
Btnl4 T C 17: 34,469,379 D475G probably damaging Het
C1qtnf12 T A 4: 155,965,613 F190Y probably damaging Het
Cacul1 A G 19: 60,534,245 S284P probably damaging Het
Ccdc166 C A 15: 75,981,971 V87L possibly damaging Het
Ceacam13 C T 7: 18,013,107 P162S probably damaging Het
Cep250 T A 2: 155,992,526 S2124T probably benign Het
Chd5 T C 4: 152,378,207 S1372P probably damaging Het
Chil3 C A 3: 106,160,414 R145L probably benign Het
Cyp4f40 T C 17: 32,675,949 S454P probably benign Het
Defa3 T A 8: 21,288,197 C66S probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Glmp C A 3: 88,328,042 N260K probably benign Het
Gsap T A 5: 21,281,018 L653Q probably damaging Het
Il18rap T A 1: 40,525,095 Y124* probably null Het
Lao1 A C 4: 118,963,751 K58T probably damaging Het
Lepr T A 4: 101,765,290 probably null Het
Mrgpra3 G C 7: 47,590,033 I48M probably benign Het
Nck2 T G 1: 43,554,351 N239K probably benign Het
Olfr1208 A G 2: 88,896,934 I221T probably benign Het
Olfr360 A T 2: 37,068,782 Y159F probably damaging Het
Olfr65 G A 7: 103,906,701 W84* probably null Het
Optc A T 1: 133,897,816 V324E possibly damaging Het
Otog T C 7: 46,273,781 S1027P probably damaging Het
Plbd2 A G 5: 120,503,342 F84L probably benign Het
Plxnb1 T C 9: 109,106,770 L110P probably damaging Het
Prnp T C 2: 131,936,788 V120A possibly damaging Het
Ptprh C A 7: 4,549,371 E965* probably null Het
Reln T C 5: 22,034,570 T900A probably damaging Het
Stt3a A G 9: 36,735,386 Y644H probably damaging Het
Sulf2 A G 2: 166,087,119 Y311H probably damaging Het
Tbc1d32 A T 10: 56,180,530 I438N probably damaging Het
Tbcd T C 11: 121,497,111 V356A possibly damaging Het
Tecta T C 9: 42,392,129 N69S probably damaging Het
Topaz1 T C 9: 122,801,958 V1618A probably benign Het
Usp48 C T 4: 137,625,276 T627I possibly damaging Het
Vcl T C 14: 20,987,075 V247A probably damaging Het
Vmn2r59 A G 7: 42,043,853 L441P probably damaging Het
Other mutations in Zfp869
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0494:Zfp869 UTSW 8 69706404 missense probably damaging 1.00
R1902:Zfp869 UTSW 8 69707438 missense probably benign 0.00
R2411:Zfp869 UTSW 8 69706529 missense probably damaging 1.00
R4687:Zfp869 UTSW 8 69708143 missense probably benign 0.00
R4691:Zfp869 UTSW 8 69706863 nonsense probably null
R5591:Zfp869 UTSW 8 69707692 missense probably benign 0.00
R7143:Zfp869 UTSW 8 69706656 missense probably damaging 1.00
R7219:Zfp869 UTSW 8 69706706 missense probably damaging 1.00
R7278:Zfp869 UTSW 8 69706478 missense probably damaging 1.00
R7808:Zfp869 UTSW 8 69706986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACACTGTTTACAGATAAAAGGTTCC -3'
(R):5'- CGGTAAAGCCTTTAGGTGTCAG -3'

Sequencing Primer
(F):5'- AGGTTCCCCCTTGTCGTGAG -3'
(R):5'- AAAGCCTTTAGGTGTCAGTCCTCG -3'
Posted On2018-10-18