Incidental Mutation 'R6859:Vcl'
List |< first << previous [record 41 of 43] next >> last >|
ID537819
Institutional Source Beutler Lab
Gene Symbol Vcl
Ensembl Gene ENSMUSG00000021823
Gene Namevinculin
Synonymsmetavinculin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6859 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location20929398-21033676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20987075 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 247 (V247A)
Ref Sequence ENSEMBL: ENSMUSP00000022369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022369]
Predicted Effect probably damaging
Transcript: ENSMUST00000022369
AA Change: V247A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022369
Gene: ENSMUSG00000021823
AA Change: V247A

DomainStartEndE-ValueType
Pfam:Vinculin 3 485 9e-203 PFAM
Pfam:Vinculin 475 1066 1.7e-301 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vinculin is a cytoskeletal protein associated with cell-cell and cell-matrix junctions, where it is thought to function as one of several interacting proteins involved in anchoring F-actin to the membrane. Defects in VCL are the cause of cardiomyopathy dilated type 1W. Dilated cardiomyopathy is a disorder characterized by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die by embryonic day 10 with failed midline fusion of the rostral neural tube, bilobular cranial development and compromised cranial and spinal nerve development. Abnormal myocardial and endocardial structures are seen in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,935 V788A possibly damaging Het
Abca15 A T 7: 120,402,994 K1577* probably null Het
Arhgap12 T C 18: 6,111,803 E187G probably damaging Het
Arhgef10 T A 8: 14,975,005 Y398N probably damaging Het
Baz2b C T 2: 59,901,530 V2055I probably benign Het
Btnl4 T C 17: 34,469,379 D475G probably damaging Het
C1qtnf12 T A 4: 155,965,613 F190Y probably damaging Het
Cacul1 A G 19: 60,534,245 S284P probably damaging Het
Ccdc166 C A 15: 75,981,971 V87L possibly damaging Het
Ceacam13 C T 7: 18,013,107 P162S probably damaging Het
Cep250 T A 2: 155,992,526 S2124T probably benign Het
Chd5 T C 4: 152,378,207 S1372P probably damaging Het
Chil3 C A 3: 106,160,414 R145L probably benign Het
Cyp4f40 T C 17: 32,675,949 S454P probably benign Het
Defa3 T A 8: 21,288,197 C66S probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Glmp C A 3: 88,328,042 N260K probably benign Het
Gsap T A 5: 21,281,018 L653Q probably damaging Het
Il18rap T A 1: 40,525,095 Y124* probably null Het
Lao1 A C 4: 118,963,751 K58T probably damaging Het
Lepr T A 4: 101,765,290 probably null Het
Mrgpra3 G C 7: 47,590,033 I48M probably benign Het
Nck2 T G 1: 43,554,351 N239K probably benign Het
Olfr1208 A G 2: 88,896,934 I221T probably benign Het
Olfr360 A T 2: 37,068,782 Y159F probably damaging Het
Olfr65 G A 7: 103,906,701 W84* probably null Het
Optc A T 1: 133,897,816 V324E possibly damaging Het
Otog T C 7: 46,273,781 S1027P probably damaging Het
Plbd2 A G 5: 120,503,342 F84L probably benign Het
Plxnb1 T C 9: 109,106,770 L110P probably damaging Het
Prnp T C 2: 131,936,788 V120A possibly damaging Het
Ptprh C A 7: 4,549,371 E965* probably null Het
Reln T C 5: 22,034,570 T900A probably damaging Het
Stt3a A G 9: 36,735,386 Y644H probably damaging Het
Sulf2 A G 2: 166,087,119 Y311H probably damaging Het
Tbc1d32 A T 10: 56,180,530 I438N probably damaging Het
Tbcd T C 11: 121,497,111 V356A possibly damaging Het
Tecta T C 9: 42,392,129 N69S probably damaging Het
Topaz1 T C 9: 122,801,958 V1618A probably benign Het
Usp48 C T 4: 137,625,276 T627I possibly damaging Het
Vmn2r59 A G 7: 42,043,853 L441P probably damaging Het
Zfp869 C T 8: 69,706,525 G466D probably damaging Het
Other mutations in Vcl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Vcl APN 14 20987003 missense probably benign 0.00
IGL01755:Vcl APN 14 20995970 missense probably damaging 0.99
IGL01994:Vcl APN 14 21003243 missense probably damaging 1.00
IGL02128:Vcl APN 14 21020577 missense probably benign
IGL02168:Vcl APN 14 21007287 missense probably benign 0.21
IGL02502:Vcl APN 14 21019385 missense probably damaging 1.00
IGL02574:Vcl APN 14 20929575 nonsense probably null
IGL03103:Vcl APN 14 21024280 missense probably damaging 1.00
IGL03046:Vcl UTSW 14 21022017 missense possibly damaging 0.52
R0137:Vcl UTSW 14 20987015 nonsense probably null
R0320:Vcl UTSW 14 20985624 splice site probably benign
R1442:Vcl UTSW 14 20983378 missense probably damaging 1.00
R1546:Vcl UTSW 14 21008950 missense probably damaging 1.00
R1692:Vcl UTSW 14 21024182 missense probably damaging 0.99
R1709:Vcl UTSW 14 21019373 missense probably benign 0.03
R1737:Vcl UTSW 14 21020536 missense probably damaging 1.00
R1848:Vcl UTSW 14 21008995 missense probably benign 0.03
R1902:Vcl UTSW 14 20982699 missense probably damaging 1.00
R4623:Vcl UTSW 14 21014939 missense probably benign 0.33
R4654:Vcl UTSW 14 20985752 splice site probably null
R5084:Vcl UTSW 14 21008959 missense possibly damaging 0.54
R5168:Vcl UTSW 14 21010102 missense probably damaging 1.00
R5275:Vcl UTSW 14 21010078 missense probably damaging 1.00
R6637:Vcl UTSW 14 21003132 missense probably damaging 1.00
R7348:Vcl UTSW 14 21003150 missense probably benign
R7348:Vcl UTSW 14 21008952 nonsense probably null
R7532:Vcl UTSW 14 21029324 missense probably damaging 1.00
R7630:Vcl UTSW 14 20983402 nonsense probably null
R7650:Vcl UTSW 14 20995046 missense probably damaging 1.00
R7812:Vcl UTSW 14 20995090 missense probably benign 0.02
X0028:Vcl UTSW 14 20985662 nonsense probably null
X0060:Vcl UTSW 14 21020776 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GGCCCACTCAAATGGTCAAAG -3'
(R):5'- AGGCTACACACTTCAGCTTTC -3'

Sequencing Primer
(F):5'- TCAAATGGTCAAAGAGAAATAACCC -3'
(R):5'- ACACACTTCAGCTTTCTACCAG -3'
Posted On2018-10-18