Incidental Mutation 'R6859:Cyp4f40'
List |< first << previous [record 14 of 43] next >> last >|
ID537822
Institutional Source Beutler Lab
Gene Symbol Cyp4f40
Ensembl Gene ENSMUSG00000090700
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 40
SynonymsEG631304
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6859 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32659410-32676687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32675949 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 454 (S454P)
Ref Sequence ENSEMBL: ENSMUSP00000129536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165061]
Predicted Effect probably benign
Transcript: ENSMUST00000165061
AA Change: S454P

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000129536
Gene: ENSMUSG00000090700
AA Change: S454P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 52 515 2.2e-130 PFAM
Meta Mutation Damage Score 0.2936 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP4F11, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F2, is approximately 16 kb away. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,935 V788A possibly damaging Het
Abca15 A T 7: 120,402,994 K1577* probably null Het
Arhgap12 T C 18: 6,111,803 E187G probably damaging Het
Arhgef10 T A 8: 14,975,005 Y398N probably damaging Het
Baz2b C T 2: 59,901,530 V2055I probably benign Het
Btnl4 T C 17: 34,469,379 D475G probably damaging Het
C1qtnf12 T A 4: 155,965,613 F190Y probably damaging Het
Cacul1 A G 19: 60,534,245 S284P probably damaging Het
Ccdc166 C A 15: 75,981,971 V87L possibly damaging Het
Ceacam13 C T 7: 18,013,107 P162S probably damaging Het
Cep250 T A 2: 155,992,526 S2124T probably benign Het
Chd5 T C 4: 152,378,207 S1372P probably damaging Het
Chil3 C A 3: 106,160,414 R145L probably benign Het
Defa3 T A 8: 21,288,197 C66S probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Glmp C A 3: 88,328,042 N260K probably benign Het
Gsap T A 5: 21,281,018 L653Q probably damaging Het
Il18rap T A 1: 40,525,095 Y124* probably null Het
Lao1 A C 4: 118,963,751 K58T probably damaging Het
Lepr T A 4: 101,765,290 probably null Het
Mrgpra3 G C 7: 47,590,033 I48M probably benign Het
Nck2 T G 1: 43,554,351 N239K probably benign Het
Olfr1208 A G 2: 88,896,934 I221T probably benign Het
Olfr360 A T 2: 37,068,782 Y159F probably damaging Het
Olfr65 G A 7: 103,906,701 W84* probably null Het
Optc A T 1: 133,897,816 V324E possibly damaging Het
Otog T C 7: 46,273,781 S1027P probably damaging Het
Plbd2 A G 5: 120,503,342 F84L probably benign Het
Plxnb1 T C 9: 109,106,770 L110P probably damaging Het
Prnp T C 2: 131,936,788 V120A possibly damaging Het
Ptprh C A 7: 4,549,371 E965* probably null Het
Reln T C 5: 22,034,570 T900A probably damaging Het
Stt3a A G 9: 36,735,386 Y644H probably damaging Het
Sulf2 A G 2: 166,087,119 Y311H probably damaging Het
Tbc1d32 A T 10: 56,180,530 I438N probably damaging Het
Tbcd T C 11: 121,497,111 V356A possibly damaging Het
Tecta T C 9: 42,392,129 N69S probably damaging Het
Topaz1 T C 9: 122,801,958 V1618A probably benign Het
Usp48 C T 4: 137,625,276 T627I possibly damaging Het
Vcl T C 14: 20,987,075 V247A probably damaging Het
Vmn2r59 A G 7: 42,043,853 L441P probably damaging Het
Zfp869 C T 8: 69,706,525 G466D probably damaging Het
Other mutations in Cyp4f40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Cyp4f40 APN 17 32667974 missense probably benign 0.00
IGL01563:Cyp4f40 APN 17 32673956 missense probably damaging 0.99
IGL01801:Cyp4f40 APN 17 32676305 missense probably damaging 1.00
IGL01960:Cyp4f40 APN 17 32659561 missense probably benign 0.25
IGL02387:Cyp4f40 APN 17 32668010 missense probably damaging 1.00
IGL02631:Cyp4f40 APN 17 32675635 splice site probably benign
IGL02967:Cyp4f40 APN 17 32674248 missense probably damaging 1.00
R0030:Cyp4f40 UTSW 17 32675973 missense probably damaging 1.00
R0103:Cyp4f40 UTSW 17 32676308 missense probably damaging 1.00
R0103:Cyp4f40 UTSW 17 32676309 nonsense probably null
R0180:Cyp4f40 UTSW 17 32659667 missense probably benign 0.00
R1413:Cyp4f40 UTSW 17 32673939 missense probably benign 0.35
R2882:Cyp4f40 UTSW 17 32668073 missense probably benign 0.05
R3903:Cyp4f40 UTSW 17 32659624 missense possibly damaging 0.51
R4378:Cyp4f40 UTSW 17 32668029 missense probably null 0.44
R4465:Cyp4f40 UTSW 17 32671212 missense probably benign 0.00
R4808:Cyp4f40 UTSW 17 32674275 missense probably benign 0.23
R5377:Cyp4f40 UTSW 17 32675616 missense probably null 0.61
R5395:Cyp4f40 UTSW 17 32669853 missense probably benign 0.01
R5523:Cyp4f40 UTSW 17 32669822 missense probably damaging 0.98
R5889:Cyp4f40 UTSW 17 32675757 missense probably benign 0.15
R6624:Cyp4f40 UTSW 17 32671180 missense possibly damaging 0.82
R6692:Cyp4f40 UTSW 17 32675742 missense possibly damaging 0.48
R7792:Cyp4f40 UTSW 17 32671169 missense probably damaging 1.00
Z1088:Cyp4f40 UTSW 17 32674002 splice site probably null
Z1177:Cyp4f40 UTSW 17 32671159 missense probably benign 0.04
Z1177:Cyp4f40 UTSW 17 32676449 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCACAACCCAACTGTGTGGC -3'
(R):5'- TCGAGTTTAGGCCACAATACAAC -3'

Sequencing Primer
(F):5'- AACTGTGTGGCGGGACC -3'
(R):5'- GAGCCCCACAGCTATTGC -3'
Posted On2018-10-18