Incidental Mutation 'R6859:Btnl4'
List |< first << previous [record 6 of 43] next >> last >|
ID537823
Institutional Source Beutler Lab
Gene Symbol Btnl4
Ensembl Gene ENSMUSG00000058435
Gene Namebutyrophilin-like 4
SynonymsBtnl4, EG632126, NG11
MMRRC Submission
Accession Numbers

Genbank: NM_001039241; MGI: 1932036

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6859 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34469042-34475937 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34469379 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 475 (D475G)
Ref Sequence ENSEMBL: ENSMUSP00000064161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065841]
Predicted Effect probably damaging
Transcript: ENSMUST00000065841
AA Change: D475G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064161
Gene: ENSMUSG00000058435
AA Change: D475G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 145 2.44e-7 SMART
Pfam:C2-set_2 150 233 3.6e-6 PFAM
low complexity region 255 268 N/A INTRINSIC
low complexity region 316 328 N/A INTRINSIC
PRY 341 386 7.43e-2 SMART
SPRY 387 510 4.67e-20 SMART
low complexity region 514 554 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,935 V788A possibly damaging Het
Abca15 A T 7: 120,402,994 K1577* probably null Het
Arhgap12 T C 18: 6,111,803 E187G probably damaging Het
Arhgef10 T A 8: 14,975,005 Y398N probably damaging Het
Baz2b C T 2: 59,901,530 V2055I probably benign Het
C1qtnf12 T A 4: 155,965,613 F190Y probably damaging Het
Cacul1 A G 19: 60,534,245 S284P probably damaging Het
Ccdc166 C A 15: 75,981,971 V87L possibly damaging Het
Ceacam13 C T 7: 18,013,107 P162S probably damaging Het
Cep250 T A 2: 155,992,526 S2124T probably benign Het
Chd5 T C 4: 152,378,207 S1372P probably damaging Het
Chil3 C A 3: 106,160,414 R145L probably benign Het
Cyp4f40 T C 17: 32,675,949 S454P probably benign Het
Defa3 T A 8: 21,288,197 C66S probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Glmp C A 3: 88,328,042 N260K probably benign Het
Gsap T A 5: 21,281,018 L653Q probably damaging Het
Il18rap T A 1: 40,525,095 Y124* probably null Het
Lao1 A C 4: 118,963,751 K58T probably damaging Het
Lepr T A 4: 101,765,290 probably null Het
Mrgpra3 G C 7: 47,590,033 I48M probably benign Het
Nck2 T G 1: 43,554,351 N239K probably benign Het
Olfr1208 A G 2: 88,896,934 I221T probably benign Het
Olfr360 A T 2: 37,068,782 Y159F probably damaging Het
Olfr65 G A 7: 103,906,701 W84* probably null Het
Optc A T 1: 133,897,816 V324E possibly damaging Het
Otog T C 7: 46,273,781 S1027P probably damaging Het
Plbd2 A G 5: 120,503,342 F84L probably benign Het
Plxnb1 T C 9: 109,106,770 L110P probably damaging Het
Prnp T C 2: 131,936,788 V120A possibly damaging Het
Ptprh C A 7: 4,549,371 E965* probably null Het
Reln T C 5: 22,034,570 T900A probably damaging Het
Stt3a A G 9: 36,735,386 Y644H probably damaging Het
Sulf2 A G 2: 166,087,119 Y311H probably damaging Het
Tbc1d32 A T 10: 56,180,530 I438N probably damaging Het
Tbcd T C 11: 121,497,111 V356A possibly damaging Het
Tecta T C 9: 42,392,129 N69S probably damaging Het
Topaz1 T C 9: 122,801,958 V1618A probably benign Het
Usp48 C T 4: 137,625,276 T627I possibly damaging Het
Vcl T C 14: 20,987,075 V247A probably damaging Het
Vmn2r59 A G 7: 42,043,853 L441P probably damaging Het
Zfp869 C T 8: 69,706,525 G466D probably damaging Het
Other mutations in Btnl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02451:Btnl4 APN 17 34475927 missense probably benign 0.34
FR4589:Btnl4 UTSW 17 34472636 missense probably benign 0.30
N/A:Btnl4 UTSW 17 34472586 splice site probably benign
PIT4458001:Btnl4 UTSW 17 34474268 missense probably benign 0.25
R0601:Btnl4 UTSW 17 34469311 missense probably benign 0.07
R0718:Btnl4 UTSW 17 34469634 missense probably benign 0.44
R1163:Btnl4 UTSW 17 34470075 missense possibly damaging 0.65
R1823:Btnl4 UTSW 17 34475852 critical splice donor site probably null
R1954:Btnl4 UTSW 17 34472930 missense possibly damaging 0.87
R1955:Btnl4 UTSW 17 34472930 missense possibly damaging 0.87
R4649:Btnl4 UTSW 17 34472628 missense probably benign 0.12
R4651:Btnl4 UTSW 17 34472628 missense probably benign 0.12
R4681:Btnl4 UTSW 17 34470101 splice site probably null
R6081:Btnl4 UTSW 17 34474236 missense probably damaging 1.00
R6770:Btnl4 UTSW 17 34474037 missense probably benign 0.26
R6885:Btnl4 UTSW 17 34472945 missense probably benign 0.00
R7265:Btnl4 UTSW 17 34475894 missense probably benign 0.00
R7316:Btnl4 UTSW 17 34469057 missense probably benign 0.06
R7454:Btnl4 UTSW 17 34472374 missense probably benign
R7908:Btnl4 UTSW 17 34473187 missense possibly damaging 0.71
R7989:Btnl4 UTSW 17 34473187 missense possibly damaging 0.71
X0023:Btnl4 UTSW 17 34475930 missense possibly damaging 0.61
Z1177:Btnl4 UTSW 17 34470060 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGACTCAGAGACTCCTCCAAAG -3'
(R):5'- TTTCTCAGAGTGTCCACATAAGGG -3'

Sequencing Primer
(F):5'- GGAAGCAAAACTAATTTCTTCCCC -3'
(R):5'- TCCACATAAGGGGTTTTGGAC -3'
Posted On2018-10-18