Incidental Mutation 'R6859:Arhgap12'
List |< first << previous [record 3 of 43] next >> last >|
ID537824
Institutional Source Beutler Lab
Gene Symbol Arhgap12
Ensembl Gene ENSMUSG00000041225
Gene NameRho GTPase activating protein 12
Synonyms2810011M08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6859 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location6024427-6136098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6111803 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 187 (E187G)
Ref Sequence ENSEMBL: ENSMUSP00000054209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062584] [ENSMUST00000077128] [ENSMUST00000182038] [ENSMUST00000182066] [ENSMUST00000182213] [ENSMUST00000182383] [ENSMUST00000182559]
Predicted Effect probably damaging
Transcript: ENSMUST00000062584
AA Change: E187G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054209
Gene: ENSMUSG00000041225
AA Change: E187G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 456 569 9.56e-11 SMART
low complexity region 571 580 N/A INTRINSIC
low complexity region 588 602 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
RhoGAP 659 833 5.47e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077128
AA Change: E187G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000076376
Gene: ENSMUSG00000041225
AA Change: E187G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 431 544 9.56e-11 SMART
low complexity region 546 555 N/A INTRINSIC
low complexity region 563 577 N/A INTRINSIC
low complexity region 591 602 N/A INTRINSIC
RhoGAP 634 808 5.47e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182038
AA Change: E187G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000138150
Gene: ENSMUSG00000041225
AA Change: E187G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182066
AA Change: E187G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000138496
Gene: ENSMUSG00000041225
AA Change: E187G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 309 341 5.5e0 SMART
PH 409 522 9.56e-11 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
RhoGAP 612 786 5.47e-64 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182213
AA Change: E187G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138464
Gene: ENSMUSG00000041225
AA Change: E187G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 461 574 9.56e-11 SMART
low complexity region 576 585 N/A INTRINSIC
low complexity region 593 607 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
RhoGAP 664 838 5.47e-64 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182383
AA Change: E187G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138444
Gene: ENSMUSG00000041225
AA Change: E187G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 309 341 5.5e0 SMART
PH 384 497 9.56e-11 SMART
low complexity region 499 508 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
RhoGAP 587 761 5.47e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182559
AA Change: E187G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000138585
Gene: ENSMUSG00000041225
AA Change: E187G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 456 569 9.56e-11 SMART
low complexity region 571 580 N/A INTRINSIC
low complexity region 588 602 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
RhoGAP 659 833 5.47e-64 SMART
Predicted Effect
Meta Mutation Damage Score 0.0720 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large family of proteins that activate Rho-type guanosine triphosphate (GTP) metabolizing enzymes. The encoded protein may be involved in suppressing tumor formation by regulating cell invasion and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: A null gene trap mutation resulted in no notable phenotype in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,935 V788A possibly damaging Het
Abca15 A T 7: 120,402,994 K1577* probably null Het
Arhgef10 T A 8: 14,975,005 Y398N probably damaging Het
Baz2b C T 2: 59,901,530 V2055I probably benign Het
Btnl4 T C 17: 34,469,379 D475G probably damaging Het
C1qtnf12 T A 4: 155,965,613 F190Y probably damaging Het
Cacul1 A G 19: 60,534,245 S284P probably damaging Het
Ccdc166 C A 15: 75,981,971 V87L possibly damaging Het
Ceacam13 C T 7: 18,013,107 P162S probably damaging Het
Cep250 T A 2: 155,992,526 S2124T probably benign Het
Chd5 T C 4: 152,378,207 S1372P probably damaging Het
Chil3 C A 3: 106,160,414 R145L probably benign Het
Cyp4f40 T C 17: 32,675,949 S454P probably benign Het
Defa3 T A 8: 21,288,197 C66S probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Glmp C A 3: 88,328,042 N260K probably benign Het
Gsap T A 5: 21,281,018 L653Q probably damaging Het
Il18rap T A 1: 40,525,095 Y124* probably null Het
Lao1 A C 4: 118,963,751 K58T probably damaging Het
Lepr T A 4: 101,765,290 probably null Het
Mrgpra3 G C 7: 47,590,033 I48M probably benign Het
Nck2 T G 1: 43,554,351 N239K probably benign Het
Olfr1208 A G 2: 88,896,934 I221T probably benign Het
Olfr360 A T 2: 37,068,782 Y159F probably damaging Het
Olfr65 G A 7: 103,906,701 W84* probably null Het
Optc A T 1: 133,897,816 V324E possibly damaging Het
Otog T C 7: 46,273,781 S1027P probably damaging Het
Plbd2 A G 5: 120,503,342 F84L probably benign Het
Plxnb1 T C 9: 109,106,770 L110P probably damaging Het
Prnp T C 2: 131,936,788 V120A possibly damaging Het
Ptprh C A 7: 4,549,371 E965* probably null Het
Reln T C 5: 22,034,570 T900A probably damaging Het
Stt3a A G 9: 36,735,386 Y644H probably damaging Het
Sulf2 A G 2: 166,087,119 Y311H probably damaging Het
Tbc1d32 A T 10: 56,180,530 I438N probably damaging Het
Tbcd T C 11: 121,497,111 V356A possibly damaging Het
Tecta T C 9: 42,392,129 N69S probably damaging Het
Topaz1 T C 9: 122,801,958 V1618A probably benign Het
Usp48 C T 4: 137,625,276 T627I possibly damaging Het
Vcl T C 14: 20,987,075 V247A probably damaging Het
Vmn2r59 A G 7: 42,043,853 L441P probably damaging Het
Zfp869 C T 8: 69,706,525 G466D probably damaging Het
Other mutations in Arhgap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Arhgap12 APN 18 6057576 missense probably benign 0.01
IGL01652:Arhgap12 APN 18 6061853 missense possibly damaging 0.89
IGL01886:Arhgap12 APN 18 6027613 missense probably damaging 1.00
IGL02716:Arhgap12 APN 18 6111857 missense possibly damaging 0.95
IGL03195:Arhgap12 APN 18 6031766 missense probably damaging 1.00
IGL03134:Arhgap12 UTSW 18 6111936 missense probably benign 0.22
R0312:Arhgap12 UTSW 18 6061982 intron probably benign
R0330:Arhgap12 UTSW 18 6039382 missense probably damaging 1.00
R0600:Arhgap12 UTSW 18 6064433 intron probably benign
R0891:Arhgap12 UTSW 18 6026699 missense probably damaging 1.00
R1123:Arhgap12 UTSW 18 6031822 missense probably damaging 1.00
R1395:Arhgap12 UTSW 18 6037058 missense probably benign 0.20
R1644:Arhgap12 UTSW 18 6112340 missense probably benign 0.00
R2968:Arhgap12 UTSW 18 6111732 missense probably damaging 1.00
R2970:Arhgap12 UTSW 18 6111732 missense probably damaging 1.00
R3809:Arhgap12 UTSW 18 6037057 missense probably benign 0.36
R3824:Arhgap12 UTSW 18 6061930 missense possibly damaging 0.80
R4181:Arhgap12 UTSW 18 6111734 missense probably damaging 1.00
R4182:Arhgap12 UTSW 18 6111734 missense probably damaging 1.00
R4183:Arhgap12 UTSW 18 6111734 missense probably damaging 1.00
R4497:Arhgap12 UTSW 18 6111774 missense probably damaging 1.00
R4498:Arhgap12 UTSW 18 6111774 missense probably damaging 1.00
R5456:Arhgap12 UTSW 18 6112170 nonsense probably null
R5539:Arhgap12 UTSW 18 6111932 missense probably benign 0.00
R5915:Arhgap12 UTSW 18 6037016 critical splice donor site probably null
R6960:Arhgap12 UTSW 18 6111901 missense probably damaging 1.00
R7114:Arhgap12 UTSW 18 6028056 missense probably damaging 1.00
R7285:Arhgap12 UTSW 18 6111920 missense probably damaging 1.00
R7359:Arhgap12 UTSW 18 6065709 missense possibly damaging 0.92
R8048:Arhgap12 UTSW 18 6052883 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GATCGACTCTGTGTGTTCCG -3'
(R):5'- GCCAATCAGAATTTCGGATCC -3'

Sequencing Primer
(F):5'- TGTTCCGAACACATAAAGCAAAAC -3'
(R):5'- CGGATCCAATTATAATTCAGGCCAG -3'
Posted On2018-10-18