Incidental Mutation 'R6831:Hbs1l'
ID 537858
Institutional Source Beutler Lab
Gene Symbol Hbs1l
Ensembl Gene ENSMUSG00000019977
Gene Name Hbs1-like (S. cerevisiae)
Synonyms 2810035F15Rik, eRFS
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6831 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 21295979-21368898 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21341868 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 228 (S228P)
Ref Sequence ENSEMBL: ENSMUSP00000151689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020153] [ENSMUST00000218032] [ENSMUST00000218714] [ENSMUST00000219915]
AlphaFold Q69ZS7
Predicted Effect probably benign
Transcript: ENSMUST00000020153
AA Change: S225P

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020153
Gene: ENSMUSG00000019977
AA Change: S225P

DomainStartEndE-ValueType
Pfam:HBS1_N 33 125 1e-22 PFAM
low complexity region 142 155 N/A INTRINSIC
Pfam:GTP_EFTU 256 521 1.7e-48 PFAM
Pfam:GTP_EFTU_D3 572 681 9.2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218032
Predicted Effect probably benign
Transcript: ENSMUST00000218714
Predicted Effect probably benign
Transcript: ENSMUST00000219915
AA Change: S228P

PolyPhen 2 Score 0.291 (Sensitivity: 0.91; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP-binding elongation factor family. It is expressed in multiple tissues with the highest expression in heart and skeletal muscle. The intergenic region of this gene and the MYB gene has been identified to be a quantitative trait locus (QTL) controlling fetal hemoglobin level, and this region influnces erythrocyte, platelet, and monocyte counts as well as erythrocyte volume and hemoglobin content. DNA polymorphisms at this region associate with fetal hemoglobin levels and pain crises in sickle cell disease. A single nucleotide polymorphism in exon 1 of this gene is significantly associated with severity in beta-thalassemia/Hemoglobin E. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T G 10: 29,224,679 D349E probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Akr1cl C T 1: 65,014,672 probably null Het
Alcam A G 16: 52,309,901 Y29H probably benign Het
Alg3 A T 16: 20,608,747 S25T probably damaging Het
Amdhd1 T G 10: 93,527,256 L323F probably damaging Het
Apcdd1 C A 18: 62,950,126 Y342* probably null Het
Aqp9 T A 9: 71,162,420 probably benign Het
Arhgef5 A G 6: 43,280,999 T1326A probably damaging Het
B020004J07Rik T A 4: 101,836,897 Q263L probably benign Het
Cacna1a T C 8: 84,571,231 V1238A probably damaging Het
Cep128 T C 12: 91,266,974 D440G probably damaging Het
Dnah5 G C 15: 28,411,515 G3677R possibly damaging Het
Dst T A 1: 34,190,684 C2631S probably benign Het
E330034G19Rik T C 14: 24,296,095 S25P probably benign Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fat3 C A 9: 16,376,551 V559L probably damaging Het
Fra10ac1 A T 19: 38,207,289 I162K probably benign Het
Glrx3 C T 7: 137,459,222 T195M possibly damaging Het
Gm9268 G C 7: 43,023,580 A143P probably damaging Het
Gm9949 T A 18: 62,180,545 probably benign Het
Hmcn1 G A 1: 150,770,293 T718I probably benign Het
Igf1r T C 7: 68,207,319 S1010P possibly damaging Het
Inpp5d T A 1: 87,701,476 Y394* probably null Het
Itpr2 G A 6: 146,112,429 T2623M probably damaging Het
Kif21b T A 1: 136,144,758 C67* probably null Het
Lama1 T A 17: 67,756,754 C758S possibly damaging Het
Mdga1 T A 17: 29,887,516 K274* probably null Het
Neu2 G A 1: 87,596,733 G147R probably damaging Het
Nkx1-1 A T 5: 33,433,803 S58R unknown Het
Olfr677 A G 7: 105,056,879 D211G possibly damaging Het
Olfr698 A T 7: 106,752,571 N272K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacs1 T A 19: 5,160,795 I151F probably damaging Het
Pamr1 C T 2: 102,614,931 R270C probably damaging Het
Pclo C T 5: 14,788,429 Q1417* probably null Het
Pkm G C 9: 59,675,115 M409I probably benign Het
Plbd2 T A 5: 120,493,066 K215N probably benign Het
Polk T C 13: 96,495,491 K245E possibly damaging Het
Prl T G 13: 27,059,547 I65S probably benign Het
Proser3 T C 7: 30,540,356 H441R probably benign Het
Psmb3 A G 11: 97,706,902 K98R probably benign Het
Ptpn20 T C 14: 33,632,925 V319A probably damaging Het
Ptprj A T 2: 90,460,647 Y397N probably damaging Het
Rp1 T C 1: 4,349,864 probably null Het
Sgsm1 T A 5: 113,280,380 Y314F probably damaging Het
Sh3pxd2a G A 19: 47,283,093 R244C probably damaging Het
Sspo G A 6: 48,484,833 V3466M possibly damaging Het
Syne2 T A 12: 75,966,794 F2921I probably benign Het
Trank1 T A 9: 111,377,899 M1700K probably benign Het
Trmt112 T A 19: 6,910,195 L4H probably damaging Het
Trmu A G 15: 85,895,006 T285A probably benign Het
Ttn A G 2: 76,771,502 probably null Het
Zc3hav1 A T 6: 38,332,168 M573K probably benign Het
Zcchc8 T C 5: 123,700,909 E522G probably damaging Het
Zfp354a T C 11: 51,070,554 S529P probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Hbs1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Hbs1l APN 10 21307756 missense probably benign 0.03
IGL02948:Hbs1l APN 10 21341711 splice site probably benign
R0375:Hbs1l UTSW 10 21342541 missense possibly damaging 0.76
R0465:Hbs1l UTSW 10 21352041 missense probably null 0.85
R0555:Hbs1l UTSW 10 21349323 missense probably benign 0.14
R0909:Hbs1l UTSW 10 21307738 missense probably benign 0.00
R1172:Hbs1l UTSW 10 21304638 missense probably damaging 1.00
R1594:Hbs1l UTSW 10 21352023 missense probably benign 0.00
R1612:Hbs1l UTSW 10 21358835 missense probably damaging 1.00
R1869:Hbs1l UTSW 10 21358406 splice site probably null
R2109:Hbs1l UTSW 10 21341932 nonsense probably null
R2369:Hbs1l UTSW 10 21307745 missense probably benign 0.01
R2404:Hbs1l UTSW 10 21296047 start gained probably benign
R4077:Hbs1l UTSW 10 21352602 missense probably damaging 1.00
R4079:Hbs1l UTSW 10 21352602 missense probably damaging 1.00
R4534:Hbs1l UTSW 10 21341915 missense possibly damaging 0.74
R4796:Hbs1l UTSW 10 21342506 missense probably damaging 1.00
R4852:Hbs1l UTSW 10 21358388 missense possibly damaging 0.92
R5069:Hbs1l UTSW 10 21354647 missense probably damaging 1.00
R5946:Hbs1l UTSW 10 21341756 missense probably benign
R6232:Hbs1l UTSW 10 21307758 splice site probably null
R6264:Hbs1l UTSW 10 21367757 missense possibly damaging 0.92
R6542:Hbs1l UTSW 10 21304617 missense probably benign 0.11
R7295:Hbs1l UTSW 10 21310152 missense probably benign 0.12
R7470:Hbs1l UTSW 10 21358784 missense possibly damaging 0.96
R7652:Hbs1l UTSW 10 21364760 missense probably benign 0.02
R7695:Hbs1l UTSW 10 21299217 missense possibly damaging 0.49
R7909:Hbs1l UTSW 10 21358404 critical splice donor site probably null
R8325:Hbs1l UTSW 10 21307649 missense probably benign 0.02
R8353:Hbs1l UTSW 10 21309279 missense probably benign
R8453:Hbs1l UTSW 10 21309279 missense probably benign
R8861:Hbs1l UTSW 10 21345064 splice site probably benign
R8878:Hbs1l UTSW 10 21358812 missense possibly damaging 0.47
R8880:Hbs1l UTSW 10 21309969 missense probably damaging 0.99
R8933:Hbs1l UTSW 10 21367685 nonsense probably null
R9462:Hbs1l UTSW 10 21342405 missense probably damaging 1.00
R9654:Hbs1l UTSW 10 21307705 missense possibly damaging 0.95
X0018:Hbs1l UTSW 10 21351987 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACTCAGTTGGGCAGTGTC -3'
(R):5'- TTTAAGCCTACACTGCTCCAAG -3'

Sequencing Primer
(F):5'- GGCAGTGTCTGAAATGACTTTCTCAC -3'
(R):5'- TACACTGCTCCAAGAGGCTG -3'
Posted On 2018-10-18