Incidental Mutation 'R6831:Polk'
ID537868
Institutional Source Beutler Lab
Gene Symbol Polk
Ensembl Gene ENSMUSG00000021668
Gene Namepolymerase (DNA directed), kappa
SynonymsDinb1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R6831 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location96480690-96542579 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96495491 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 245 (K245E)
Ref Sequence ENSEMBL: ENSMUSP00000152322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022172] [ENSMUST00000091387] [ENSMUST00000165358] [ENSMUST00000220977] [ENSMUST00000221645] [ENSMUST00000221899] [ENSMUST00000222075] [ENSMUST00000222143] [ENSMUST00000222389]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022172
AA Change: K325E

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022172
Gene: ENSMUSG00000021668
AA Change: K325E

DomainStartEndE-ValueType
Pfam:IMS 105 324 1.7e-47 PFAM
Pfam:IMS_C 406 525 5.5e-22 PFAM
PDB:2LSJ|B 559 582 9e-8 PDB
ZnF_Rad18 619 645 2.89e-9 SMART
ZnF_Rad18 761 787 2.31e-8 SMART
low complexity region 828 839 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000091387
AA Change: K266E

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088950
Gene: ENSMUSG00000021668
AA Change: K266E

DomainStartEndE-ValueType
Pfam:IMS 105 265 1.1e-37 PFAM
Pfam:IMS_C 346 469 8.8e-19 PFAM
PDB:2LSJ|B 500 523 9e-8 PDB
ZnF_Rad18 560 586 2.89e-9 SMART
ZnF_Rad18 702 728 2.31e-8 SMART
low complexity region 769 780 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165358
Predicted Effect possibly damaging
Transcript: ENSMUST00000220977
AA Change: K245E

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000221645
AA Change: K325E

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000221899
AA Change: K245E

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000222075
Predicted Effect probably benign
Transcript: ENSMUST00000222143
AA Change: K245E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222389
AA Change: K245E

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA polymerase type-Y family of proteins. The encoded protein is a specialized DNA polymerase that catalyzes translesion DNA synthesis, which allows DNA replication in the presence of DNA lesions. Human cell lines lacking a functional copy of this gene exhibit impaired genome integrity and enhanced susceptibility to oxidative damage. Mutations in this gene that impair enzyme activity may be associated with prostate cancer in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation of this gene that results in a truncated transcript results in a higher rate of spontaneous germline expanded simple tandem repeat mutations. Homozyogus null mice exhibit normal immunoglobulin gene somatic hypermutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T G 10: 29,224,679 D349E probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Akr1cl C T 1: 65,014,672 probably null Het
Alcam A G 16: 52,309,901 Y29H probably benign Het
Alg3 A T 16: 20,608,747 S25T probably damaging Het
Amdhd1 T G 10: 93,527,256 L323F probably damaging Het
Apcdd1 C A 18: 62,950,126 Y342* probably null Het
Aqp9 T A 9: 71,162,420 probably benign Het
Arhgef5 A G 6: 43,280,999 T1326A probably damaging Het
B020004J07Rik T A 4: 101,836,897 Q263L probably benign Het
Cacna1a T C 8: 84,571,231 V1238A probably damaging Het
Cep128 T C 12: 91,266,974 D440G probably damaging Het
Dnah5 G C 15: 28,411,515 G3677R possibly damaging Het
Dst T A 1: 34,190,684 C2631S probably benign Het
E330034G19Rik T C 14: 24,296,095 S25P probably benign Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fat3 C A 9: 16,376,551 V559L probably damaging Het
Fra10ac1 A T 19: 38,207,289 I162K probably benign Het
Glrx3 C T 7: 137,459,222 T195M possibly damaging Het
Gm9268 G C 7: 43,023,580 A143P probably damaging Het
Gm9949 T A 18: 62,180,545 probably benign Het
Hbs1l T C 10: 21,341,868 S228P probably benign Het
Hmcn1 G A 1: 150,770,293 T718I probably benign Het
Igf1r T C 7: 68,207,319 S1010P possibly damaging Het
Inpp5d T A 1: 87,701,476 Y394* probably null Het
Itpr2 G A 6: 146,112,429 T2623M probably damaging Het
Kif21b T A 1: 136,144,758 C67* probably null Het
Lama1 T A 17: 67,756,754 C758S possibly damaging Het
Mdga1 T A 17: 29,887,516 K274* probably null Het
Neu2 G A 1: 87,596,733 G147R probably damaging Het
Nkx1-1 A T 5: 33,433,803 S58R unknown Het
Olfr677 A G 7: 105,056,879 D211G possibly damaging Het
Olfr698 A T 7: 106,752,571 N272K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacs1 T A 19: 5,160,795 I151F probably damaging Het
Pamr1 C T 2: 102,614,931 R270C probably damaging Het
Pclo C T 5: 14,788,429 Q1417* probably null Het
Pkm G C 9: 59,675,115 M409I probably benign Het
Plbd2 T A 5: 120,493,066 K215N probably benign Het
Prl T G 13: 27,059,547 I65S probably benign Het
Proser3 T C 7: 30,540,356 H441R probably benign Het
Psmb3 A G 11: 97,706,902 K98R probably benign Het
Ptpn20 T C 14: 33,632,925 V319A probably damaging Het
Ptprj A T 2: 90,460,647 Y397N probably damaging Het
Rp1 T C 1: 4,349,864 probably null Het
Sgsm1 T A 5: 113,280,380 Y314F probably damaging Het
Sh3pxd2a G A 19: 47,283,093 R244C probably damaging Het
Sspo G A 6: 48,484,833 V3466M possibly damaging Het
Syne2 T A 12: 75,966,794 F2921I probably benign Het
Trank1 T A 9: 111,377,899 M1700K probably benign Het
Trmt112 T A 19: 6,910,195 L4H probably damaging Het
Trmu A G 15: 85,895,006 T285A probably benign Het
Ttn A G 2: 76,771,502 probably null Het
Zc3hav1 A T 6: 38,332,168 M573K probably benign Het
Zcchc8 T C 5: 123,700,909 E522G probably damaging Het
Zfp354a T C 11: 51,070,554 S529P probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Polk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Polk APN 13 96496760 missense probably benign 0.25
IGL01803:Polk APN 13 96504522 missense probably damaging 1.00
IGL01949:Polk APN 13 96483538 missense probably benign 0.10
IGL01986:Polk APN 13 96483823 missense probably benign 0.09
IGL02073:Polk APN 13 96504551 missense probably damaging 1.00
IGL03165:Polk APN 13 96516688 missense probably benign 0.23
IGL03184:Polk APN 13 96483983 missense probably benign 0.04
IGL03353:Polk APN 13 96489211 missense probably damaging 1.00
R0019:Polk UTSW 13 96504616 missense probably damaging 1.00
R0029:Polk UTSW 13 96516670 missense probably damaging 1.00
R0200:Polk UTSW 13 96496822 missense probably benign 0.11
R0357:Polk UTSW 13 96504597 missense probably damaging 0.99
R0485:Polk UTSW 13 96483764 missense probably benign 0.05
R0555:Polk UTSW 13 96484179 missense probably damaging 0.97
R0687:Polk UTSW 13 96484017 missense probably damaging 1.00
R0980:Polk UTSW 13 96483764 missense probably benign 0.05
R1065:Polk UTSW 13 96508252 missense probably damaging 1.00
R1396:Polk UTSW 13 96484208 missense probably benign 0.02
R1710:Polk UTSW 13 96489204 missense probably damaging 1.00
R1770:Polk UTSW 13 96495442 missense probably damaging 1.00
R1789:Polk UTSW 13 96496632 missense probably damaging 1.00
R1977:Polk UTSW 13 96489228 missense probably damaging 1.00
R2301:Polk UTSW 13 96484144 missense probably benign 0.09
R3797:Polk UTSW 13 96486982 splice site probably benign
R3934:Polk UTSW 13 96501635 missense possibly damaging 0.56
R4082:Polk UTSW 13 96483673 missense probably benign 0.17
R4307:Polk UTSW 13 96496666 missense possibly damaging 0.79
R4472:Polk UTSW 13 96493905 missense probably damaging 1.00
R4779:Polk UTSW 13 96496491 critical splice donor site probably null
R4795:Polk UTSW 13 96489256 missense probably benign 0.01
R4796:Polk UTSW 13 96489256 missense probably benign 0.01
R4810:Polk UTSW 13 96483495 missense possibly damaging 0.90
R5002:Polk UTSW 13 96489244 missense probably damaging 1.00
R5271:Polk UTSW 13 96483539 missense probably benign 0.09
R5415:Polk UTSW 13 96483955 missense probably benign
R5459:Polk UTSW 13 96495476 missense probably damaging 1.00
R5535:Polk UTSW 13 96495497 missense probably damaging 1.00
R5619:Polk UTSW 13 96483556 missense probably damaging 1.00
R5757:Polk UTSW 13 96484252 missense probably benign 0.03
R5801:Polk UTSW 13 96483586 missense probably damaging 1.00
R5923:Polk UTSW 13 96495415 missense probably damaging 1.00
R6365:Polk UTSW 13 96484009 missense probably damaging 1.00
R6670:Polk UTSW 13 96496630 nonsense probably null
R6932:Polk UTSW 13 96516681 missense probably damaging 1.00
R7216:Polk UTSW 13 96508220 missense probably benign 0.32
R7654:Polk UTSW 13 96496813 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCAACGACAGTTACGATCAGC -3'
(R):5'- CTCAAGTCACCTGCTGCCATAG -3'

Sequencing Primer
(F):5'- ACAGTTACGATCAGCCAGTGGTTC -3'
(R):5'- AGCTAATCTATTCCCTTTCCCTAAAC -3'
Posted On2018-10-18