Incidental Mutation 'R6831:Ptpn20'
ID537870
Institutional Source Beutler Lab
Gene Symbol Ptpn20
Ensembl Gene ENSMUSG00000021940
Gene Nameprotein tyrosine phosphatase, non-receptor type 20
Synonymstyp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6831 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location33589207-33640754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33632925 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 319 (V319A)
Ref Sequence ENSEMBL: ENSMUSP00000022508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022508] [ENSMUST00000226512] [ENSMUST00000227887]
Predicted Effect probably damaging
Transcript: ENSMUST00000022508
AA Change: V319A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022508
Gene: ENSMUSG00000021940
AA Change: V319A

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PTPc 164 420 1.12e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226512
Predicted Effect probably benign
Transcript: ENSMUST00000227887
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of classical tyrosine-specific protein tyrosine phosphatases. Many protein tyrosine phosphatases have been shown to regulate fundamental cellular processes. The encoded protein appears to be targeted to sites of actin polymerization. A pseudogene of this gene has been defined on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T G 10: 29,224,679 D349E probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Akr1cl C T 1: 65,014,672 probably null Het
Alcam A G 16: 52,309,901 Y29H probably benign Het
Alg3 A T 16: 20,608,747 S25T probably damaging Het
Amdhd1 T G 10: 93,527,256 L323F probably damaging Het
Apcdd1 C A 18: 62,950,126 Y342* probably null Het
Aqp9 T A 9: 71,162,420 probably benign Het
Arhgef5 A G 6: 43,280,999 T1326A probably damaging Het
B020004J07Rik T A 4: 101,836,897 Q263L probably benign Het
Cacna1a T C 8: 84,571,231 V1238A probably damaging Het
Cep128 T C 12: 91,266,974 D440G probably damaging Het
Dnah5 G C 15: 28,411,515 G3677R possibly damaging Het
Dst T A 1: 34,190,684 C2631S probably benign Het
E330034G19Rik T C 14: 24,296,095 S25P probably benign Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fat3 C A 9: 16,376,551 V559L probably damaging Het
Fra10ac1 A T 19: 38,207,289 I162K probably benign Het
Glrx3 C T 7: 137,459,222 T195M possibly damaging Het
Gm9268 G C 7: 43,023,580 A143P probably damaging Het
Gm9949 T A 18: 62,180,545 probably benign Het
Hbs1l T C 10: 21,341,868 S228P probably benign Het
Hmcn1 G A 1: 150,770,293 T718I probably benign Het
Igf1r T C 7: 68,207,319 S1010P possibly damaging Het
Inpp5d T A 1: 87,701,476 Y394* probably null Het
Itpr2 G A 6: 146,112,429 T2623M probably damaging Het
Kif21b T A 1: 136,144,758 C67* probably null Het
Lama1 T A 17: 67,756,754 C758S possibly damaging Het
Mdga1 T A 17: 29,887,516 K274* probably null Het
Neu2 G A 1: 87,596,733 G147R probably damaging Het
Nkx1-1 A T 5: 33,433,803 S58R unknown Het
Olfr677 A G 7: 105,056,879 D211G possibly damaging Het
Olfr698 A T 7: 106,752,571 N272K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacs1 T A 19: 5,160,795 I151F probably damaging Het
Pamr1 C T 2: 102,614,931 R270C probably damaging Het
Pclo C T 5: 14,788,429 Q1417* probably null Het
Pkm G C 9: 59,675,115 M409I probably benign Het
Plbd2 T A 5: 120,493,066 K215N probably benign Het
Polk T C 13: 96,495,491 K245E possibly damaging Het
Prl T G 13: 27,059,547 I65S probably benign Het
Proser3 T C 7: 30,540,356 H441R probably benign Het
Psmb3 A G 11: 97,706,902 K98R probably benign Het
Ptprj A T 2: 90,460,647 Y397N probably damaging Het
Rp1 T C 1: 4,349,864 probably null Het
Sgsm1 T A 5: 113,280,380 Y314F probably damaging Het
Sh3pxd2a G A 19: 47,283,093 R244C probably damaging Het
Sspo G A 6: 48,484,833 V3466M possibly damaging Het
Syne2 T A 12: 75,966,794 F2921I probably benign Het
Trank1 T A 9: 111,377,899 M1700K probably benign Het
Trmt112 T A 19: 6,910,195 L4H probably damaging Het
Trmu A G 15: 85,895,006 T285A probably benign Het
Ttn A G 2: 76,771,502 probably null Het
Zc3hav1 A T 6: 38,332,168 M573K probably benign Het
Zcchc8 T C 5: 123,700,909 E522G probably damaging Het
Zfp354a T C 11: 51,070,554 S529P probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Ptpn20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Ptpn20 APN 14 33622619 missense probably benign 0.22
IGL01510:Ptpn20 APN 14 33638386 splice site probably null
R2057:Ptpn20 UTSW 14 33630985 missense probably damaging 0.98
R2262:Ptpn20 UTSW 14 33612311 missense probably benign
R3106:Ptpn20 UTSW 14 33612296 missense probably benign
R3430:Ptpn20 UTSW 14 33614528 missense possibly damaging 0.61
R4645:Ptpn20 UTSW 14 33631212 missense probably benign
R4928:Ptpn20 UTSW 14 33614489 missense probably benign 0.00
R4962:Ptpn20 UTSW 14 33614459 missense probably benign 0.02
R5087:Ptpn20 UTSW 14 33614441 missense possibly damaging 0.90
R5163:Ptpn20 UTSW 14 33631111 missense probably benign 0.07
R5275:Ptpn20 UTSW 14 33631192 missense probably benign 0.00
R6325:Ptpn20 UTSW 14 33631005 missense possibly damaging 0.52
R6651:Ptpn20 UTSW 14 33632940 missense probably damaging 1.00
R6903:Ptpn20 UTSW 14 33614504 missense probably damaging 0.98
R7034:Ptpn20 UTSW 14 33614435 makesense probably null
R7036:Ptpn20 UTSW 14 33614435 makesense probably null
R7265:Ptpn20 UTSW 14 33614524 missense probably benign 0.05
R7654:Ptpn20 UTSW 14 33638324
Predicted Primers PCR Primer
(F):5'- ATGGAGAAAAGCTAATTCTGGCAAC -3'
(R):5'- AGTAGTTCTTCTCGATGGCAG -3'

Sequencing Primer
(F):5'- GCTAATTCTGGCAACTTTCAGAG -3'
(R):5'- TCTTCTCGATGGCAGAGAAC -3'
Posted On2018-10-18