Incidental Mutation 'R6831:Adam28'
ID537871
Institutional Source Beutler Lab
Gene Symbol Adam28
Ensembl Gene ENSMUSG00000014725
Gene Namea disintegrin and metallopeptidase domain 28
SynonymsD430033C21Rik, C130072N01Rik, MDC-L, Dtgn1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R6831 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location68606027-68655842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 68618127 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 630 (A630T)
Ref Sequence ENSEMBL: ENSMUSP00000106701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022642] [ENSMUST00000111072] [ENSMUST00000224039]
Predicted Effect probably benign
Transcript: ENSMUST00000022642
AA Change: A630T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000022642
Gene: ENSMUSG00000014725
AA Change: A630T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.5e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.7e-19 PFAM
Pfam:Reprolysin 206 402 5.6e-70 PFAM
Pfam:Reprolysin_2 226 392 1e-16 PFAM
Pfam:Reprolysin_3 230 353 1.2e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111072
AA Change: A630T

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106701
Gene: ENSMUSG00000014725
AA Change: A630T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.3e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.3e-19 PFAM
Pfam:Reprolysin 206 402 5.3e-70 PFAM
Pfam:Reprolysin_2 226 392 9.9e-17 PFAM
Pfam:Reprolysin_3 230 353 1.1e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224039
AA Change: A630T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are typically membrane-anchored, although a form of this protein may be secreted. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a mature protein product. This protein may bind to integrins and regulate lymphocyte migration by enhancing cell adhesion. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T G 10: 29,224,679 D349E probably benign Het
Akr1cl C T 1: 65,014,672 probably null Het
Alcam A G 16: 52,309,901 Y29H probably benign Het
Alg3 A T 16: 20,608,747 S25T probably damaging Het
Amdhd1 T G 10: 93,527,256 L323F probably damaging Het
Apcdd1 C A 18: 62,950,126 Y342* probably null Het
Aqp9 T A 9: 71,162,420 probably benign Het
Arhgef5 A G 6: 43,280,999 T1326A probably damaging Het
B020004J07Rik T A 4: 101,836,897 Q263L probably benign Het
Cacna1a T C 8: 84,571,231 V1238A probably damaging Het
Cep128 T C 12: 91,266,974 D440G probably damaging Het
Dnah5 G C 15: 28,411,515 G3677R possibly damaging Het
Dst T A 1: 34,190,684 C2631S probably benign Het
E330034G19Rik T C 14: 24,296,095 S25P probably benign Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fat3 C A 9: 16,376,551 V559L probably damaging Het
Fra10ac1 A T 19: 38,207,289 I162K probably benign Het
Glrx3 C T 7: 137,459,222 T195M possibly damaging Het
Gm9268 G C 7: 43,023,580 A143P probably damaging Het
Gm9949 T A 18: 62,180,545 probably benign Het
Hbs1l T C 10: 21,341,868 S228P probably benign Het
Hmcn1 G A 1: 150,770,293 T718I probably benign Het
Igf1r T C 7: 68,207,319 S1010P possibly damaging Het
Inpp5d T A 1: 87,701,476 Y394* probably null Het
Itpr2 G A 6: 146,112,429 T2623M probably damaging Het
Kif21b T A 1: 136,144,758 C67* probably null Het
Lama1 T A 17: 67,756,754 C758S possibly damaging Het
Mdga1 T A 17: 29,887,516 K274* probably null Het
Neu2 G A 1: 87,596,733 G147R probably damaging Het
Nkx1-1 A T 5: 33,433,803 S58R unknown Het
Olfr677 A G 7: 105,056,879 D211G possibly damaging Het
Olfr698 A T 7: 106,752,571 N272K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacs1 T A 19: 5,160,795 I151F probably damaging Het
Pamr1 C T 2: 102,614,931 R270C probably damaging Het
Pclo C T 5: 14,788,429 Q1417* probably null Het
Pkm G C 9: 59,675,115 M409I probably benign Het
Plbd2 T A 5: 120,493,066 K215N probably benign Het
Polk T C 13: 96,495,491 K245E possibly damaging Het
Prl T G 13: 27,059,547 I65S probably benign Het
Proser3 T C 7: 30,540,356 H441R probably benign Het
Psmb3 A G 11: 97,706,902 K98R probably benign Het
Ptpn20 T C 14: 33,632,925 V319A probably damaging Het
Ptprj A T 2: 90,460,647 Y397N probably damaging Het
Rp1 T C 1: 4,349,864 probably null Het
Sgsm1 T A 5: 113,280,380 Y314F probably damaging Het
Sh3pxd2a G A 19: 47,283,093 R244C probably damaging Het
Sspo G A 6: 48,484,833 V3466M possibly damaging Het
Syne2 T A 12: 75,966,794 F2921I probably benign Het
Trank1 T A 9: 111,377,899 M1700K probably benign Het
Trmt112 T A 19: 6,910,195 L4H probably damaging Het
Trmu A G 15: 85,895,006 T285A probably benign Het
Ttn A G 2: 76,771,502 probably null Het
Zc3hav1 A T 6: 38,332,168 M573K probably benign Het
Zcchc8 T C 5: 123,700,909 E522G probably damaging Het
Zfp354a T C 11: 51,070,554 S529P probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Adam28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Adam28 APN 14 68622120 missense possibly damaging 0.47
IGL00654:Adam28 APN 14 68649428 missense probably benign 0.00
IGL01021:Adam28 APN 14 68642114 missense probably benign
IGL01099:Adam28 APN 14 68637329 critical splice donor site probably null
IGL01349:Adam28 APN 14 68611006 missense probably benign 0.01
IGL01744:Adam28 APN 14 68607507 missense probably benign 0.07
IGL01805:Adam28 APN 14 68642091 missense probably benign 0.09
IGL02007:Adam28 APN 14 68633219 missense possibly damaging 0.69
IGL02828:Adam28 APN 14 68646870 missense possibly damaging 0.46
IGL03180:Adam28 APN 14 68637434 missense probably damaging 1.00
IGL03355:Adam28 APN 14 68634803 splice site probably benign
IGL02980:Adam28 UTSW 14 68619806 missense probably benign 0.01
PIT4453001:Adam28 UTSW 14 68634876 missense probably benign 0.00
R0184:Adam28 UTSW 14 68637373 missense probably benign 0.33
R0321:Adam28 UTSW 14 68617751 missense probably damaging 0.97
R0329:Adam28 UTSW 14 68617739 missense probably damaging 0.96
R0494:Adam28 UTSW 14 68630792 splice site probably benign
R0605:Adam28 UTSW 14 68606600 unclassified probably benign
R0732:Adam28 UTSW 14 68637347 missense probably benign 0.00
R0959:Adam28 UTSW 14 68607938 missense possibly damaging 0.93
R1319:Adam28 UTSW 14 68609129 missense probably benign 0.28
R1745:Adam28 UTSW 14 68633171 missense probably benign 0.04
R1836:Adam28 UTSW 14 68649421 missense possibly damaging 0.85
R1838:Adam28 UTSW 14 68639210 missense possibly damaging 0.53
R1839:Adam28 UTSW 14 68639210 missense possibly damaging 0.53
R1850:Adam28 UTSW 14 68639195 missense probably benign 0.01
R1912:Adam28 UTSW 14 68644331 missense probably benign 0.24
R2830:Adam28 UTSW 14 68626914 missense possibly damaging 0.65
R2889:Adam28 UTSW 14 68634845 missense possibly damaging 0.85
R3977:Adam28 UTSW 14 68610994 missense probably benign 0.20
R3978:Adam28 UTSW 14 68610994 missense probably benign 0.20
R3979:Adam28 UTSW 14 68610994 missense probably benign 0.20
R4282:Adam28 UTSW 14 68647706 missense possibly damaging 0.92
R4416:Adam28 UTSW 14 68622082 critical splice donor site probably null
R4690:Adam28 UTSW 14 68642048 missense probably benign 0.01
R4724:Adam28 UTSW 14 68626877 missense probably damaging 0.99
R4768:Adam28 UTSW 14 68634815 missense possibly damaging 0.46
R4883:Adam28 UTSW 14 68638103 missense probably damaging 0.99
R5054:Adam28 UTSW 14 68617715 missense probably damaging 1.00
R5710:Adam28 UTSW 14 68609908 missense probably damaging 0.96
R5835:Adam28 UTSW 14 68655681 missense possibly damaging 0.96
R6002:Adam28 UTSW 14 68642062 missense probably benign
R6054:Adam28 UTSW 14 68642152 missense probably benign 0.01
R6349:Adam28 UTSW 14 68633172 missense probably benign 0.29
R6449:Adam28 UTSW 14 68630667 missense probably benign 0.31
R6455:Adam28 UTSW 14 68633208 missense probably damaging 1.00
R6833:Adam28 UTSW 14 68618127 missense probably benign 0.04
R7212:Adam28 UTSW 14 68637397 missense probably damaging 0.99
R7411:Adam28 UTSW 14 68626947 missense probably damaging 1.00
R7422:Adam28 UTSW 14 68626877 missense probably damaging 1.00
R7516:Adam28 UTSW 14 68630676 missense probably damaging 1.00
R7649:Adam28 UTSW 14 68634833 missense probably benign 0.12
R7765:Adam28 UTSW 14 68609106 critical splice donor site probably null
Z1177:Adam28 UTSW 14 68626784 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCCTATATCCTCCTAGAGTGTC -3'
(R):5'- ACCTGCTAGTGTTTTCCTAATAAAAT -3'

Sequencing Primer
(F):5'- TCCTCCTAGAGTGTCAGATAAGC -3'
(R):5'- TTGACCATACTCTAGTGGAAGGCC -3'
Posted On2018-10-18